We narrowed to 1,509 results for: U6 promoter
-
Plasmid#176664PurposeExpression of sgRNA under mosquito consensus U6 promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pLib6.4-Aaeg_774
Plasmid#176659PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL017774) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Agam_695
Plasmid#176668PurposeExpression of sgRNA under An. gambiae U6-2 (AGAP013695) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_TFRC_B
Plasmid#72626PurposeExpresses two gRNAs targeting the TFRC promoterDepositorInsertgRNAs toward TFRC
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
SauCas9 EMX1-nicking sgRNA
Plasmid#169860PurposeSauCas9 nicking sgRNA for EMX1DepositorInsertSauCas9 EMX1-nicking sgRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
px552-sg-gria1-HT-SEP
Plasmid#187653PurposeContains HaloTag-SEP to be inserted into the NTD of Gria1 (via HITI) and single guide RNA to target Cas9 to Gria1 under control of the U6 promoter.DepositorInsertHaloTag-SEP donor
UseAAV and CRISPRTagsN/APromoterN/AAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpyCas9 EMX1-nicking sgRNA
Plasmid#169859PurposeSpyCas9 nicking sgRNA for EMX1DepositorInsertSpyCas9 EMX1-nicking sgRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_B
Plasmid#72621PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aalb_744
Plasmid#176663PurposeExpression of sgRNA under Ae. albopictus U6 (AALF029744) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Spy EMX1-pegRNA
Plasmid#169855PurposeSpyCas9-pegRNA for EMX1DepositorInsertSpy EMX1-pegRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6nH1-HD10kb
Plasmid#172657PurposeExpressing paired pegRNAs from human U6 and H1 promoters to make 10204-bp deletion on HPRT1 geneDepositorInsertpegRNA-HD10kbA/pegRNA-HD10kbB
UseCRISPRAvailable SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_D
Plasmid#72623PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Cquin_596
Plasmid#176655PurposeExpression of sgRNA under C. quinquefasciatus U6 (CPIJ039596) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B
Plasmid#176665PurposeExpression of sgRNA under D. melanogaster U6-2 _(_CR32867) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_E
Plasmid#72624PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLib6.6B
Plasmid#176666PurposeExpression of sgRNA under D. melanogaster U6-3 _(CR31539) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEN_hU6miR-Luc-A
Plasmid#25756PurposeEntry vector with human U6 promoter driving control Luciferase miR30-based shRNA.DepositorInsertLuciferase miR-shRNA
UseGateway CloningAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mNeurog2 gRNA_1-MS2-Puro
Plasmid#192680PurposeLentiviral expression of sgRNA targeting mIL1RN promoter to activate mouse Neurog2 transcriptionDepositorInsertMouse Neurog2 activating gRNA #1 (Neurog2 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-MS2tail-SAM
Plasmid#78905PurposeVector for expressing a single sgRNA with SAM MS2 tail, under U6:3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable SinceAug. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Cquin_596
Plasmid#176669PurposeExpression of sgRNA under C. quinquefasciatus U6 (CPIJ039596) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aalb_726
Plasmid#176661PurposeExpression of sgRNA under Ae. albopictus U6 (AALF029726) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aaeg_763
Plasmid#176658PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL017763) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
SauCas9KKH CCR5-nicking sgRNA
Plasmid#169863PurposeSauCas9KKH nicking sgRNA for CCR5DepositorInsertSauCas9KKH CCR5-nicking sgRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-MS2tail-Scaffold
Plasmid#78906PurposeVector for expressing a single sgRNA with Scaffold MS2 tail, under U6:3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable SinceSept. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTGC-U6.2
Plasmid#112809PurposePCR template vector for amplifying gRNAcore-pU6.3 promoter fragmentDepositorInsertU6:2-gRNAcore
ExpressionBacterialAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTK73_htz-1
Plasmid#174546Purposehtz-1 targeting gRNA expressionDepositorInserthtz-1 targeting gRNA
ExpressionWormPromoterCe-U6 promoterAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Cquin_728
Plasmid#176656PurposeExpression of sgRNA under C. quinquefasciatus U6 (CPIJ039728) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Agam_557
Plasmid#176667PurposeExpression of sgRNA under An. gambiae U6-1 (AGAP013557) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Aaeg_972
Plasmid#176674PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL028972) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Agam_557
Plasmid#176653PurposeExpression of sgRNA under An. gambiae U6-1 (AGAP013557) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Aalb_726
Plasmid#176675PurposeExpression of sgRNA under Ae. albopictus U6 (AALF029726) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Aaeg_763
Plasmid#176672PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL017763) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aaeg_972
Plasmid#176660PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL028972) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Cquin_801
Plasmid#176657PurposeExpression of sgRNA under C. quinquefasciatus U6 (CPIJ039801) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Cquin_801
Plasmid#176671PurposeExpression of sgRNA under C. quinquefasciatus U6 (CPIJ039801) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Cquin_728
Plasmid#176670PurposeExpression of sgRNA under C. quinquefasciatus U6 (CPIJ039728) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTGC-U6.3
Plasmid#112810PurposePCR template vector for amplifying gRNAcore-pU6.2 promoter fragmentDepositorInsertU6:3-gRNAcore
ExpressionBacterialAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Blast
Plasmid#199622PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and blasticidin resistance from EF-1a promoter.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only