We narrowed to 648 results for: pgk promoter
-
Plasmid#194703PurposeInducible lentiviral expression, TRE-RPS2-APOBEC-HA-P2A-mRuby; PGK-puro-2A-rtTA (Ribo-STAMP, RPS2)DepositorInsertRPS2 (RPS2 Human)
UseLentiviralTagsAPOBEC1-HA-P2A-mRubyExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-LTR-dCas9-VP64-BFP
Plasmid#46912PurposeHuman expression vector containing MSCV LTR promoter, dCas9 that is fused to 2x NLS, VP64 and tagBFPDepositorInsertsdCas9-VP64-BFP fusion
Puromycin resistance
UseCRISPR and RetroviralTags3xNLS, BFP, and VP64 domainExpressionMammalianPromoterLTR and PGKAvailable SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-LTR-dCas9-p65AD-BFP
Plasmid#46913PurposeHuman expression vector containing MSCV LTR promoter, dCas9 that is fused to 2x NLS, p65 activation domain and tagBFPDepositorInsertsdCas9-p65AD-BFP fusion
Puromycin resistance
UseCRISPR and RetroviralTags2xNLS, BFP, and VP64 domainExpressionMammalianPromoterLTR and PGKAvailable SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
MSCVpuro-6xHis_SUMO2
Plasmid#164938PurposeExpresses 6xHis tagged human Small Ubiquitin Like Modifier 2 (SUMO2) wild type cDNADepositorInsertSmall Ubiquitin Like Modifier 2 (SUMO2 Human)
UseRetroviralTags6XHISPromoterPGK promoterAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
EF.GFP
Plasmid#17616DepositorAvailable SinceApril 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
pEM.P03R
Plasmid#198646PurposeEasy-MISE toolkit pEM-plasmid containing PGK1 promoter with FG protruding endsDepositorInsertpPGK1
UseSynthetic BiologyExpressionYeastAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEM.P03L
Plasmid#198645PurposeEasy-MISE toolkit pEM-plasmid containing PGK1 promoter with EF protruding endsDepositorInsertpPGK1
UseSynthetic BiologyExpressionYeastAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pLV[TetOn]-Puro-TRE3G>mAscl1
Plasmid#198755PurposeVector encodes the gene for murine Ascl1 under control of a Tet-controlled promoter and the puromycin resistance gene under control of a constitutive PGK promoterDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV[TetOn]-Puro-TRE3G>mNeurog2
Plasmid#198754PurposeVector encodes the gene for murine neurogenin-2 under control of a Tet-controlled promoter and the puromycin resistance gene under control of a constitutive PGK promoterDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBT272_(pRosa26-GTET)
Plasmid#36882DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
diphteria toxin A
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDUAL CLDN (GFP)
Plasmid#86981PurposeLentiviral expression construct encoding Claudin-1 and GFP from separate promotersDepositorAvailable SinceFeb. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
cTRE-LSL-GFP-IRES-Cas9-sgCR8
Plasmid#135668PurposeIntroduce Dox/Cre-inducible (TRE promoter followed by lox-stop-lox) Cas9 cDNA plus control-targeting sgRNA into (ES) cells by recombination-mediated cassette exchangeDepositorInsertsgCR8
UseMouse TargetingAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
cTRE-LSL-GFP-IRES-Cas9-sgPtenX1.1
Plasmid#135669PurposeIntroduce Dox/Cre-inducible (TRE promoter followed by lox-stop-lox) Cas9 cDNA plus Pten-targeting sgRNA into (ES) cells by recombination-mediated cassette exchangeDepositorInsertsgPten
UseMouse TargetingAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVPT-GDNF-tTR-KRAB
Plasmid#11646PurposeTet-regulated (Tet-on) lentiviral vector for GDNF (mPGK promoter) - 2nd generationDepositorAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only