We narrowed to 1,318 results for: grna cloning vector
-
Plasmid#112808PurposegRNA cloning vector for expressing 1-3 gRNAs in DrosophilaDepositorTypeEmpty backboneExpressionBacterialAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pTAJAK-71 (pESC-NatMXsyn-USER)
Plasmid#78232PurposeEmpty vector, for the insertion of gRNA expression cassettes into the vector.DepositorTypeEmpty backboneExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-Exoc7-Ex5&10
Plasmid#133303PurposeEGFP reporter sequence was removed from TLCV2 vector and two gRNAs targeting mouse Exoc7 gene were cloned into the modified TLCV2 vector.DepositorInsertExocyst complex component 7 (Exoc7 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromotermU6 promoterAvailable SinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-LacZ-GFP-Puro (BB)
Plasmid#170459PurposeFor cloning gRNA blockDepositorInserthU6-BB-LacZ and EF1A-EGFP-2A-Puro
UseLentiviralExpressionMammalianPromoterhU6 for gRNA and EF1A for EGFP-2A-PuroAvailable SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRI012-pGEM-PacI-PU3-BsmbI-NotI
Plasmid#140204PurposeVector for cloning Cas9 sgRNA ( Step 1 of 2-step cloning). Contains AfU3 promoter driven sgRNA expression cassette flanked by PacI and NotI for further cloning in fungal vector.DepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Step 1 of cloning c…PromoterAspergillus fumigatus U3 (RNAPIII).Available SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN_TmiR_Luc-A
Plasmid#25760PurposeEntry vector withTRE promoter driving control Luciferase miR30-based shRNA.DepositorInsertLuciferase miR-shRNA
UseGateway CloningAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEN_TGmiR_Luc-A
Plasmid#25765PurposeEntry vector withTRE promoter driving control Luciferase miR30-based shRNA with GFP coexpression.DepositorInsertLuciferase miR-shRNA
UseGateway CloningTagsGFPAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEN_hU6miR-Luc-A
Plasmid#25756PurposeEntry vector with human U6 promoter driving control Luciferase miR30-based shRNA.DepositorInsertLuciferase miR-shRNA
UseGateway CloningAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pT077
Plasmid#137879PurposeDonor vector for integration into the human AAVS1 safe harbor locus of Doxicycline-inducible KRAB-dCas9-IRES-EGFPDepositorInsertTRE3G-KRAB-dCas9-IRES-EGFP-CAG-TetON-NeoR-SA
UseAAVExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT076
Plasmid#137880PurposeDonor vector for integration at the human AAVS1 safe harbor locus of Doxicycline-inducible dCas9-VPR-T2A-EGFPDepositorInsertTRE3G-dCas9-VPR-T2A-EGFP-CAG-TetON-NeoR-SA
UseAAVExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKIR1.1
Plasmid#85758PurposeCRISPR/Cas9 in Arabidopsis with seed a fluorescent reporterDepositorInserthuman-codon-optimized SpCas9
UseCRISPRTagsFLAGExpressionPlantPromoterAtRPS5AAvailable SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT1T2.2
Plasmid#134752PurposePCR template for sgRNA cloningDepositorInsertsgRNA-AtU6_29p
UseCRISPRAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT1T2.2
Plasmid#134751PurposePCR template for sgRNA cloningDepositorInsertsgRNA-TaU3p
UseCRISPRAvailable SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGMV-U
Plasmid#112797PurposeUniversal BeYDV-derived vector for cloning of up to four gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMCL9
Plasmid#176186Purpose2 mu cloning vector for single or multiplexed gRNAs, SNR52p-sfGFP-scRNA-SUP4t-CYC1tDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 RFP670
Plasmid#187646Purposelentiviral vector expressing RFP670 alongside Cas9 and an sgRNA cloning siteDepositorInsertRFP 670
UseLentiviralTagsRFP670 and sgRNA cloning sitePromoterEFS (P2A)Available SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
PlayBack-U6-Kpn1
Plasmid#203297PurposeFor expression of sgRNAs in a PlayBack Vector with Kpn1 as a PlayBack Restriction EnzymeDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
PlayBack-U6-Xba1
Plasmid#203300PurposeFor expression of sgRNAs in a PlayBack Vector with XbaI as a PlayBack Restriction EnzymeDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
PlayBack-U6-Bamh1
Plasmid#203298PurposeFor expression of sgRNAs in a PlayBack Vector with Bamh1 as a PlayBack Restriction EnzymeDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only