We narrowed to 1,270 results for: grna cloning vector
-
Plasmid#133303PurposeEGFP reporter sequence was removed from TLCV2 vector and two gRNAs targeting mouse Exoc7 gene were cloned into the modified TLCV2 vector.DepositorInsertExocyst complex component 7 (Exoc7 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromotermU6 promoterAvailable SinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRI012-pGEM-PacI-PU3-BsmbI-NotI
Plasmid#140204PurposeVector for cloning Cas9 sgRNA ( Step 1 of 2-step cloning). Contains AfU3 promoter driven sgRNA expression cassette flanked by PacI and NotI for further cloning in fungal vector.DepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Step 1 of cloning c…PromoterAspergillus fumigatus U3 (RNAPIII).Available SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-As-crRNA
Plasmid#78956PurposeCloning vector for expression of AsCpf1 crRNA. It contains BsmB1 site for cloning.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT077
Plasmid#137879PurposeDonor vector for integration into the human AAVS1 safe harbor locus of Doxicycline-inducible KRAB-dCas9-IRES-EGFPDepositorInsertTRE3G-KRAB-dCas9-IRES-EGFP-CAG-TetON-NeoR-SA
UseAAVExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT076
Plasmid#137880PurposeDonor vector for integration at the human AAVS1 safe harbor locus of Doxicycline-inducible dCas9-VPR-T2A-EGFPDepositorInsertTRE3G-dCas9-VPR-T2A-EGFP-CAG-TetON-NeoR-SA
UseAAVExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SiC-V1
Plasmid#133041PurposeSiC-V1 vector with SpCas9 gene and dTomato reporter. sgRNA targeting a gene of interest can be cloned downstream of U6 promoter.DepositorInsertSpCas9
UseCRISPR and LentiviralTagsdTomatoAvailable SinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGC31
Plasmid#19678DepositorInsertGateway(R1-R2)-L4440
UseRNAi; Gateway destination vectorAvailable SinceFeb. 25, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGMV-U
Plasmid#112797PurposeUniversal BeYDV-derived vector for cloning of up to four gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGC49
Plasmid#19680DepositorInsertGateway(R1-R2)-L4440
UseRNAi; Gateway destination vectorAvailable SinceFeb. 25, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGC48
Plasmid#19679DepositorInsertGateway(R2-R1)-L4440
UseRNAi; Gateway destination vectorAvailable SinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRDA_122
Plasmid#208095PurposePerturb-Seq lentiviral gRNA expression vector with a 3' appended capture sequence to enable direct capture of CRISPR gRNAs for scRNA-seqDepositorInsertPuromycin resistance
UseCRISPR and LentiviralPromoterEF1aAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT1T2.2
Plasmid#134752PurposePCR template for sgRNA cloningDepositorInsertsgRNA-AtU6_29p
UseCRISPRAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT1T2.2
Plasmid#134751PurposePCR template for sgRNA cloningDepositorInsertsgRNA-TaU3p
UseCRISPRAvailable SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMCL9
Plasmid#176186Purpose2 mu cloning vector for single or multiplexed gRNAs, SNR52p-sfGFP-scRNA-SUP4t-CYC1tDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 RFP670
Plasmid#187646Purposelentiviral vector expressing RFP670 alongside Cas9 and an sgRNA cloning siteDepositorInsertRFP 670
UseLentiviralTagsRFP670 and sgRNA cloning sitePromoterEFS (P2A)Available SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
PlayBack-U6-Kpn1
Plasmid#203297PurposeFor expression of sgRNAs in a PlayBack Vector with Kpn1 as a PlayBack Restriction EnzymeDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
PlayBack-U6-Xba1
Plasmid#203300PurposeFor expression of sgRNAs in a PlayBack Vector with XbaI as a PlayBack Restriction EnzymeDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
PlayBack-U6-Bamh1
Plasmid#203298PurposeFor expression of sgRNAs in a PlayBack Vector with Bamh1 as a PlayBack Restriction EnzymeDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
PlayBack-U6-Bgl11
Plasmid#203299PurposeFor expression of sgRNAs in a PlayBack Vector with BglII as a PlayBack Restriction EnzymeDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only