We narrowed to 21,788 results for: his
-
Plasmid#71951PurposeExpresses the extracellular region of the FLRT3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertIslr2.b (Islr2 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.1-Fc-His
Plasmid#72081PurposeExpresses the extracellular region of the JAM-4, isoform 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertJam4.1 (Igsf5 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Neo1.c-AP-His
Plasmid#71965PurposeExpresses the extracellular region of the Neogenin 1, isoform c protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertNeo1.c (Neo1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plxnb2(L)-AP-His
Plasmid#72002PurposeExpresses the extracellular region of the PlexinB2 protein (ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertPlxnb2 (Plxnb2 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plxnc1-AP-His
Plasmid#72005PurposeExpresses the extracellular region of the PlexinC1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertPlxnc1 (Plxnc1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Unc5c.z-Fc-His
Plasmid#72182PurposeExpresses the extracellular region of the Unc5C, isoform z protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertUnc5c.z (Unc5c Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.c-Fc-His
Plasmid#72112PurposeExpresses the extracellular region of the Netrin G1, isoform c protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertNtng1.c (Ntng1 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sdk2-AP-His
Plasmid#72009PurposeExpresses the extracellular region of the Sdk2 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSdk2 (Sdk2 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc2-FLAGHISNDHFR
Plasmid#63965PurposePosition 2 transfer plasmid for pST44 polycistronic plasmid suite; N-term cleavable double tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneUseTags6xHis & FLAG; TEV cleavableExpressionBacterialMutationPromoterT7Available sinceOct. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
Plxnb3-AP-His
Plasmid#72004PurposeExpresses the extracellular region of the PlexinB3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertPlxnb3 (Plxnb3 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Unc5d.z-Fc-His
Plasmid#72185PurposeExpresses the extracellular region of the Unc5D, isoform z protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertUnc5d.z (Unc5d Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
unc5bCD4d3+4-His
Plasmid#36151PurposeEXPRESs plasmid for Zebrafish Receptors encoding zebrafish unc5b (netrin-1a) with rat CD4d3+4-His tagDepositorInsertunc5b (unc5b Zebrafish)
UseTagsHis tag and ratCD4d3+4ExpressionMammalianMutationL2VPromoterCMVAvailable sinceMay 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHIS-Hsv2
Plasmid#42524DepositorInsertHsv2
UseTagsHIS-TEVExpressionBacterialMutationPromoterAvailable sinceJuly 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
NLuc-His10
Plasmid#234567PurposeBacterially expressed NLuc for Ni-NTA purificationDepositorInsertNano luciferase
UseTagsT7 gene 10 leader peptide and Thrombin site-10xHi…ExpressionBacterialMutationCodon optimized for bacterial expressionPromoterT7Available sinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a:His-RWT4Ca
Plasmid#237519PurposeRecombinant protein expressionDepositorInsertRwt4Ca
UseTagsExpressionBacterialMutationPromoterAvailable sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a:His-MBP-KD
Plasmid#237520PurposeRecombinant protein expressionDepositorInsertRwt4_kinase
UseTagsExpressionBacterialMutationKinase region of RWT4PromoterAvailable sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET15bHis6-pG-Tnp
Plasmid#124884PurposeTo transform BL21-Gold(DE3) and induced by IPTG for His-proteinG-Tnp (hyperactive mutant) fusion protein.DepositorInsertprotein G's C1D1C2D2C3 domains contained in the protein G gBLOCK.
UseTagsExpressionBacterialMutationPromoterT7Available sinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET15bHis6-pG-MNase
Plasmid#124886PurposeTo transform BL21-Gold(DE3) and be induced by IPTG for His-proteinG-MNase fusion protein expression.DepositorInsertprotein G-MNase
UseTagsExpressionBacterialMutationPromoterT7Available sinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorInsertHIS3 gRNA (HIS3 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorInsertHIS3 gRNA (HIS3 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only