We narrowed to 9,129 results for: mel
-
Plasmid#84006PurposeDonor HR template carrying a 2,080 bp fragment of the Drosophila melanogaster white[coffee] allele and silent mutations conferring resistance to white sgRNAs-1, -2, -3, and -4DepositorInsertA 2,080 bp fragment of the white[coffee] allele (w Fly)
UseUnspecifiedMutationA GC-to-AA mutation that creates a G589E missense…Available SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
KHBD00476
Plasmid#39585DepositorAvailable SinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMT-Pav-GFP
Plasmid#24286DepositorAvailable SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E K91N
Plasmid#110121PurposeExpresses Flag-tagged D. melanogaster Hel25E with K91N mutation that greatly reduces helicase activityDepositorInsertHel25E (Hel25E Fly)
TagsFlagExpressionInsectMutationK91N mutationPromoterMetallothionein Promoter (pMT)Available SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E D193E
Plasmid#110120PurposeExpresses Flag-tagged D. melanogaster Hel25E with D193E mutation that greatly reduces ATP binding affinityDepositorInsertHel25E (Hel25E Fly)
TagsFlagExpressionInsectMutationD193E mutationPromoterMetallothionein Promoter (pMT)Available SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E MUT
Plasmid#110122PurposeExpresses Flag-tagged D. melanogaster Hel25E with 4 mutations that impact circRNA nuclear export activityDepositorInsertHel25E (Hel25E Fly)
TagsFlagExpressionInsectMutation4 mutations (KKLN motif changed to RSFS)PromoterMetallothionein Promoter (pMT)Available SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Donor_C_FH_Nbr
Plasmid#186662PurposeDonor plasmid to endogenously tag Nbr gene in Drosophila melanogaster at the C-terminal.DepositorInsertOSS Nbr C-terminal 3xFlag-3xHA Tag Donor Plasmid (Nbr Fly)
Tags3xFlag-3xHAExpressionInsectAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET45b-tsr(B/X) (6X-His-Dm-Cofilin)
Plasmid#128278PurposeExpresses Drosophila melanogaster Cofilin (Twinstar) in bacterial cell cultureDepositorInserttwinstar (tsr) (tsr Fly)
Tags6X Histidine tagExpressionBacterialMutationMet1 changed to Pro1; Cys77 silent basepair mutat…PromoterT7Available SinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Donor_N_FH_Piwi
Plasmid#186651PurposeDonor plasmid to endogenously tag piwi gene in Drosophila melanogaster ovarian somatic sheet (OSS) cells.DepositorInsertOSS PIWI N-terminal 3xFlag-3xHA Tag Donor Plasmid (piwi Fly)
Tags3xFlag-3xHAExpressionInsectAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
PBAN-tetOn-NKX3.1
Plasmid#238472PurposeDoxycycline inducible expression of the NKX3.1 transcription factor for mural cell differentiation.DepositorInsertNKX3.1 (NKX3-1 Human)
ExpressionMammalianAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a_DmKHC[1-421]-1xGFP-6xHis
Plasmid#196972PurposeBacterial expression plasmid for His tag-based purification of Drosophila melanogaster kinesin heavy chain [1-421] with C-terminal GFP tag and C-terminal 6xHis tagDepositorAvailable SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-CBP(1603-2678)
Plasmid#183774PurposeExpress GST-CBP(1603-2678) in E. coli. Purified GST-CBP(1603-2678) was used for in vitro acetylation assays.DepositorAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMT-FLAG-CBPΔN
Plasmid#182840PurposeA 5.2 kb Drosophila CBP cDNA fragment (cut by Nhe I and Nsi I), encoding C-terminal residues 1476-3222, was inserted into the pMT-FLAG vector. Expression in S2 cells by CuSO4 induction.DepositorInsertCBP cDNA fragment (cut by Nhe I and Nsi I) (nej Fly)
TagsFLAG tagExpressionInsectPromoterMTAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6p-1_GST-DmKHC[1-421]_1xmNeonGreen
Plasmid#196974PurposeBacterial expression plasmid for GST-based purification of Drosophila melanogaster kinesin heavy chain [1-421] with C-terminal mNeonGreen tag and cleavable N-terminal GST tagDepositorAvailable SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28a_DmKHC[1-421]-SNAP-6xHis
Plasmid#196975PurposeBacterial expression plasmid for His tag-based purification of Drosophila melanogaster kinesin heavy chain [1-421] with C-terminal SNAP tag and C-terminal 6xHis tagDepositorAvailable SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pAc5.1B-EGFP-DmPenguin_B
Plasmid#145924PurposeInsect Expression of DmPenguinDepositorInsertDmPenguin (peng Fly)
ExpressionInsectAvailable SinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
CG4845/pUAST
Plasmid#17588DepositorInsertCG4845 (psidin Fly)
ExpressionInsectAvailable SinceMarch 27, 2008AvailabilityAcademic Institutions and Nonprofits only