We narrowed to 9,230 results for: mel
-
Plasmid#175591PurposeLac inducible, AMP Resistant, fluor labelled (CFP) gene mesh1 from D. melanogaster on a low copy backbone. Used to induce controllable hydrolysis of ppGpp in E. coli.DepositorInsertMesh1 (Mesh1 Fly)
TagsFused with a flexible GS linker to ceruleanExpressionBacterialMutationCodon optimized for translation in E.coli. AGGAGG…Available SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-ovoD1
Plasmid#111142PurposeExpresses U6:3-sgRNA targeting ovoD1 mutation in Drosophila melanogasterDepositorAvailable SinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTripz Casp1-IRES-mCherry
Plasmid#187294PurposeThis is Caspase1 from mouse (NM_009807.2) with its CARD domain replaced by the FKBP-V domain (dimerising domain).DepositorAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
6xHis(TEV)-dDrp1-StrepII
Plasmid#174421PurposeExpresses D. melanogaster Drp1 in bacteriaDepositorAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E WT
Plasmid#110123PurposeExpresses Flag-tagged D. melanogaster Hel25EDepositorAvailable SinceOct. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_DUM1H01
Plasmid#71090PurposeGateway entry cloneDepositorInsertnej (nej Fly)
UseGateway entry vectorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGex4t2 with 244-458AA SUUR fragment
Plasmid#112989PurposeExpresses fusion of GST and amino acids 244-458 of Drosophila SUURDepositorAvailable SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
KHBD00717
Plasmid#39745DepositorAvailable SinceSept. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
pLVX Neo TagBFP-LC3B
Plasmid#250866PurposeStable lentiviral expression of TagBFP-LC3BDepositorAvailable SinceFeb. 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P-1 BICC FL
Plasmid#112998PurposeFor protein expression and purification of full-length Drosophila BicCDepositorInsertfull length BicC (BicC Fly)
ExpressionBacterialAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57-white[coffee]
Plasmid#84006PurposeDonor HR template carrying a 2,080 bp fragment of the Drosophila melanogaster white[coffee] allele and silent mutations conferring resistance to white sgRNAs-1, -2, -3, and -4DepositorInsertA 2,080 bp fragment of the white[coffee] allele (w Fly)
UseUnspecifiedMutationA GC-to-AA mutation that creates a G589E missense…Available SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDmAct5C::Cas9-2A-Neo
Plasmid#176679PurposeExpression of Drosophila codon optimized spCas9 under Drosophila Act5C promoterDepositorInsertspCas9; NeoR (aminoglycoside phosphotransferase from Tn5)
UseCrisprExpressionInsectMutationDrosophila codon optimizedPromoterD. melanogaster Act5CAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
KHBD00476
Plasmid#39585DepositorAvailable SinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMT-Pav-GFP
Plasmid#24286DepositorAvailable SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E K91N
Plasmid#110121PurposeExpresses Flag-tagged D. melanogaster Hel25E with K91N mutation that greatly reduces helicase activityDepositorInsertHel25E (Hel25E Fly)
TagsFlagExpressionInsectMutationK91N mutationPromoterMetallothionein Promoter (pMT)Available SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E D193E
Plasmid#110120PurposeExpresses Flag-tagged D. melanogaster Hel25E with D193E mutation that greatly reduces ATP binding affinityDepositorInsertHel25E (Hel25E Fly)
TagsFlagExpressionInsectMutationD193E mutationPromoterMetallothionein Promoter (pMT)Available SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E MUT
Plasmid#110122PurposeExpresses Flag-tagged D. melanogaster Hel25E with 4 mutations that impact circRNA nuclear export activityDepositorInsertHel25E (Hel25E Fly)
TagsFlagExpressionInsectMutation4 mutations (KKLN motif changed to RSFS)PromoterMetallothionein Promoter (pMT)Available SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only