We narrowed to 10,848 results for: ENA
-
Plasmid#103164PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-100-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-100-5p target (MIR100 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
plenti-UbcP-FLAG-YWAA-pGK-HYG
Plasmid#107375PurposeLentiviral expression of FLAG-YWAADepositorInsertcereblon (CRBN Human)
UseLentiviralTagsFLAGExpressionMammalianMutationCRBN-Y383A/W385APromoterUbcPAvailable sinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-183-5p
Plasmid#103285PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-183-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-183-5p target (MIR183 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-193a-3p
Plasmid#103305PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-193a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-193a-3p target (MIR193A Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-142-5p
Plasmid#103241PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-142-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-142-5p target (MIR142 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-143-5p
Plasmid#103243PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-143-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-143-5p target (MIR143 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hook3(1-522)-SNAPf-Psc-StrepII
Plasmid#111860PurposeC-terminal SNAPf tag on Hook3 (amino acids 1-522) for expression in Sf9 cells. C-terminal SNAPf-Psc-StrepII tag.DepositorInsertHook3(1-552)-SNAPf (HOOK3 Human)
UseTagsPsc, SNAPf, and Strep-IIExpressionInsectMutationOptimised for expression in Sf9 cellsPromoterAvailable sinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
plenti-UBC- IKZF5-3xHA-pGK-PUR
Plasmid#107385PurposeLentiviral expression of IKZF5-3xHADepositorInsertIKZF5 (IKZF5 Human)
UseLentiviralTagsHAExpressionMammalianMutationPromoterUBCAvailable sinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRC/RSV-rat Agt
Plasmid#122104PurposeExpression of angiotensinogenDepositorInsertangiotensinogen (Agt Rat)
UseTagsExpressionMammalianMutationPromoterRSV promoterAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-579-5p
Plasmid#103661PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-579-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-579-5p target (MIR579 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-302c-3p
Plasmid#103403PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-302c-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-302c-3p target (MIR302C Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-519c-3p
Plasmid#103608PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-519c-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-519c-3p target (MIR519C Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-520c-3p
Plasmid#103610PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-520c-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-520c-3p target (MIR520C Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-99b-5p
Plasmid#103767PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-99b-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-99b-5p target (MIR99B Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-26a-1-3p
Plasmid#103377PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-26a-1-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-26a-1-3p target (MIR26A1 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-26a-2-3p
Plasmid#103378PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-26a-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-26a-2-3p target (MIR26A2 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-126-5p
Plasmid#103193PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-126-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-126-5p target (MIR126 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA 27
Plasmid#132396PurposeTargets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backboneDepositorInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-31-3p
Plasmid#103420PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-31-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-31-3p target (MIR31 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-96-5p
Plasmid#103761PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-96-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-96-5p target (MIR96 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only