We narrowed to 6,228 results for: KIT;
-
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mGFAP(ABC1D)-2pabPAC
Plasmid#234547Purposeto express the optogenetic tool 2pabPAC, which increases cAMP levels when stimulated by blue light, in astrocytesDepositorInsert2pabPAC
UseAAVMutationNonePromotermGFAP(ABC1D)Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVM-SFT-SP
Plasmid#234902PurposeThis all-in-one vector is used to overexpress the GhSFT gene via virus-mediated overexpression (VOX), and specifically silence the GhSP gene via virus-induced gene silencing (VIGS), simultaneously.DepositorInsertAdditional VA component flanked with VIGS fragment of GhSP gene and coding sequence of GhSFT
ExpressionPlantAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYI2216
Plasmid#228349Purpose2,4-Diacetylphloroglucinol (DAPG)-regulatable ALX-0081 expressionDepositorInsertMFalpha(2xAdv)-LE-ALX-0081-3A-FLAG-His
UseAffinity Reagent/ AntibodyTagsAAA linker followed by FLAG-His6 and MF_ secretio…ExpressionYeastPromoter2,4-Diacetylphloroglucinol-regulatable synthetic …Available SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pMBS-864
Plasmid#218018PurposeGST-tag fused to TEV Protease cleavage site for protein purification and cleavageDepositorInsertGST-tag
UseSynthetic BiologyTagsTEV protease cleavage siteAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-848
Plasmid#218003PurposeGST-tag fused to PreScission Protease cleavage site for protein purification and cleavageDepositorInsertGST-tag
UseSynthetic BiologyTagsPreScission protease cleavage siteAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-849
Plasmid#218004Purpose8xHis-tag fused to PreScission Protease cleavage site for protein purification and cleavageDepositorInsert8xHis-tag
UseSynthetic BiologyTagsPreScission protease cleavage siteAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
LMPd Amt LDHA
Plasmid#209408PurposeRetroviral vector with Ametrine marker for expressing shRNA with an "UltramiR" microRNA scaffoldDepositorInsertLdhA shRNA (Ldha Mouse)
UseRetroviralAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(TAL1(11))-PGKpuro2ABFP-W
Plasmid#208545PurposeLentiviral vector expressing gRNA targeting human TAL1DepositorInsertTAL1(11) (TAL1 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(TAL1(12))-PGKpuro2ABFP-W
Plasmid#208546PurposeLentiviral vector expressing gRNA targeting human TAL1DepositorInsertTAL1(12) (TAL1 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MRPS26(15))-PGKpuro2ABFP-W
Plasmid#200499PurposeLentiviral vector expressing gRNA targeting human MRPS26DepositorInsertMRPS26(15) (MRPS26 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(AAVS1)-hU6gRNA5(BbsI)-PGKpuroBFP-W
Plasmid#200502PurposeLentiviral vector expressing gRNA targeting human AAVS1DepositorInsertAAVS1 (AAVS1 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MRPS26(12))-PGKpuro2ABFP-W
Plasmid#200498PurposeLentiviral vector expressing gRNA targeting human MRPS26DepositorInsertMRPS26(12) (MRPS26 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(NDUFA1(12))-PGKpuro2ABFP-W
Plasmid#200495PurposeLentiviral vector expressing gRNA targeting human NDUFA1DepositorInsertNDUFA1(12) (NDUFA1 Human)
UseLentiviralAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MRPL21(16))-PGKpuro2ABFP-W
Plasmid#200497PurposeLentiviral vector expressing gRNA targeting human MRPL21DepositorInsertMRPL21(16) (MRPL21 Human)
UseLentiviralAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(NDUFA1(11))-PGKpuro2ABFP-W
Plasmid#200494PurposeLentiviral vector expressing gRNA targeting human NDUFA1DepositorInsertNDUFA1(11) (NDUFA1 Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MRPL21(14))-PGKpuro2ABFP-W
Plasmid#200496PurposeLentiviral vector expressing gRNA targeting human MRPL21DepositorInsertMRPL21(14) (MRPL21 Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only