We narrowed to 14,538 results for: egf
-
Plasmid#191170PurposeEK0285 in plant-expressable format: Sensor 1 (for EK0208); mCherry marker, EGFP output.DepositorInsertmCherry:s70587:EGFP (plant)
ExpressionPlantMutationWTAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
R26-H2B-EGFP HR donor vector
Plasmid#137925PurposeR0SA26 knock-in vector with homologous recombination-based methodDepositorInsertSA-H2B-EGFP-bpA with homology arms
UseMouse TargetingAvailable SinceMay 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-PEmax-P2A-EGFP (LM1589)
Plasmid#223136PurposepCMV and pT7 Human expression plasmid for PEmax(nSpCas9(H840A)-M-MMLV_RT**)-P2A-EGFPDepositorInserthuman codon optimized PEmax-P2A-EGFP
UseCRISPRTagsBPNLS and NLS(SV40)-NLS(cMyc)-P2A-EGFPExpressionMammalianMutationM-MLV mutations from PE2 (Anzalone et al. Nature …PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDZ274 (pLEU MET25pro MCP-2x-yeGFP)
Plasmid#45929DepositorInsertMCP-2x-yeGFP
Tags2x-yeGFPExpressionYeastPromoterMET25Available SinceAug. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-ConVERGD-eGFP-W3SL
Plasmid#218744PurposeProvides AND intersectional (Cre+Flp) expression of eGFPDepositorInserteGFP
UseAAVPromoterEf1aAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPyPGK-HA-EGFP-Myc-TM-IRES-Pac
Plasmid#183606PurposeMammalian expression vector for membrane-tethered HA- and Myc-tagged EGFP from the mouse Pgk1 promoter. Confers puromycin resistance.DepositorInsertEGFP-TM
TagsHA, Human PDGFRB transmembrane domain, Mouse IgGK…ExpressionMammalianPromoterMouse Pgk1Available SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMK467 (dTAG-BromoTag-mAID-EGFP)
Plasmid#214393PurposedTAG-BromoTag-mAID-EGFP reporter (TOL2)DepositorInsertdTAG-BromoTag-mAID-EGFP reporter
ExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-BE4max-P2A-EGFP (pRZ33)
Plasmid#140083PurposeCAG promoter expression plasmid for human codon optimized BE4max C-to-T base editor with P2A-EGFPDepositorInsertHuman codon optimized pCAG BE4max with P2A-EGFP
TagsP2A-EGFPExpressionMammalianMutationD10A (SpCas9)PromoterCAGAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
tetO-FUW-eGFP-RHOA-T19N
Plasmid#73082PurposeLentiviral transfer vector for tet-inducible expression of EGFP tagged human RHOA-T19NDepositorAvailable SinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR SFFV GLP1R(S301A)-EGFP
Plasmid#158123PurposeLentiviral plasmid for expression of GLP1R(S301)-EGFP fusion with SFFV promoter.DepositorInsertGLP1R (GLP1R )
UseLentiviralTagsEGFPExpressionMammalianMutationSerine 301 changed to alanine to enhance membrane…PromoterSFFVAvailable SinceOct. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGal-Trans-Myc-eGFP-KDEL
Plasmid#177729PurposeER protein collagen beta (1-O) galactosyltransferase fused to eGFP at the C-terminus, myc taggedDepositorInsertcollagen beta(1-O)galactosyltransferase 1 (COLGALT1 Human)
TagsKDEL, Myc, and eGFPExpressionBacterial and MammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV:eGFP-CaM-uTEV1Δ(220-242)
Plasmid#135461PurposeMammalian expression of uFLARE protease componentDepositorInserteGFP-CaM-uTEV1Δ
TagseGFP, V5ExpressionMammalianMutationS219V mutation improves stability and S153N impro…PromoterCMVAvailable SinceJan. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-EGFP-WPRE-pA
Plasmid#37091PurposeExpresses EGFP in cells lacking Cre (Cre-Off, flanked by alternative lox FAS sites)DepositorInsertd1eGFP
UseAAV and Cre/Lox; Cre-offPromoterEF1aAvailable SinceJuly 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pPB CAG Otx2-IRES-EGFP
Plasmid#153947PurposepiggyBac transposon vector with CAG promoter expressing Otx2 and EGFPDepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMVSP6-nEGFP-SV40-PURO
Plasmid#138364PurposeLentiviral plasmid for nuclear EGFP expression driven by CMVSP6 and puromycin resistance under SV40 promoter for selectionDepositorInsertnuclear EGFP
UseLentiviralExpressionMammalianAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Phat2-dr-cPla2-C2-Y90F-V91F-EGFP-6H
Plasmid#187186PurposeProtein ExpressionDepositorAvailable SinceAug. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2-actinb-kcna1a-IRES-EGFP
Plasmid#164965PurposeTol2 construct: actinb (actb2) promoter driven zebrafish kcna1a and EGFPDepositorInsertkcna1a (kcna1a Zebrafish)
UseTol2 transposon destination vectorTagsIRES-EGFPPromoteractinb (actb2) promoterAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
EK0379 CMV-TO-EGFP-stop-t70587 (PB)
Plasmid#191154PurposeExpression of Trigger 1 in the 3' UTR of EGFP in mammalian cells; used to make a cell line to study sensors for integrated 3' UTR or CDS triggers; expression is inducible with doxycycline due to CMV-TO promoter.DepositorInsertEGFP-t70587
ExpressionMammalianMutationWTPromoterCMV-TOAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-EGFP-Human-UTROPHIN_1-261
Plasmid#222393PurposeExpress in mammalian cells the EGFP fused to residues 1-261 of Human Utrophin to detect filamentous actin in live, fix cels or tissues.DepositorInsertHuman Utrophin residues 1-261 and EGFP (UTRN Homo Sapiens, Human)
UseLentiviralTagsEGFP and Human UTROPHIN 1-261ExpressionMammalianMutationSequence is derived from ADDGENE Plasmid #26737-G…PromoterCMV promoter and enhancerAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only