We narrowed to 7,236 results for: mag
-
Plasmid#119186PurposeThe F40-based human desmoplakin I tension sensor detects forces in the range of 1-6 pN by changes in FRET between mTFP1 and mEYFP.DepositorInserthuman Desmoplakin I-[mTFP1-F40-mEYFP] (internal-1945) (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Akna-mEGFP
Plasmid#196866PurposeExpression of the centrosomal protein Akna fused to enhanced (E)-GFPDepositorInsertAkna-mEGFP (Akna Mouse)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-NES-SomaFRCaMPi
Plasmid#232836PurposeAAV transfer plasmid for CAG-mediated Cre-dependent expression of soma-targeted FRCaMPiDepositorInsertNES-FRCaMPi
UseAAVTagsnuclear export sequenceExpressionMammalianPromoterCAGAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I no force control (F40-based)
Plasmid#119187PurposeThe no force control for the F40-based human desmoplakin I tension sensor serves to detect changes in FRET between mTFP1 and mEYFP that are tension-independent.DepositorInserthuman Desmoplakinhuman Desmoplakin I (1-1945)-[mTFP1-F40-mEYFP] (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationtruncation after aa1945PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLHCX-ATF4 mScarlet NLS
Plasmid#115970PurposeER-stress sensor - ATF4 translation at ORF3 fluorescent reporter with mScarlet-I (retroviral vector backbone)DepositorInsertactivating transcription factor 4 (ATF4 Synthetic, Human)
UseRetroviralTagsHA tag, c-myc NLS, and mScarlet-IExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/T0-Flag-RECQL5
Plasmid#222620PurposeMammalian expression vector of flag-tagged RECQL5DepositorAvailable SinceJuly 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-BAZ1A
Plasmid#65371PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorInsertBAZ1A (BAZ1A Human)
TagsEmGFP and V5ExpressionMammalianMutation796I compared to all reference sequencesPromoterCMVAvailable SinceJune 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
5xQUAS:GAP-tagYFP-P2A-NfsB_Vv F70A/F108Y,he:ECFP
Plasmid#158654Purposemaking transgenics expressing a QUAS driven YFP and NTR 2.0DepositorInsert5xQUAS:GAP-tagYFP-P2A-NfsB_Vv F70A/F108Y;he:eCFP
UseTol2-based transgenic expression in zebrafish/oth…MutationF70A/F108YAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMXs-IP-mVenus-TOSI
Plasmid#172491PurposemVenus-TOSI (TOr-Signal-Indicator) is a fluorescent reporter for mTORC1 signaling (monitoring PDCD4 degradation) which can be introduced to mammalian cells by retrovirus vector.DepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-ActinVhh-sfGFP-P2A-HA-tdiRFP-caax (JDW 1532)
Plasmid#242606PurposeA CAGGS driven expression vector containing an actin nanobody fused to sfGFP to label actin followed by a HA tagged tdiRFP fused to a caax tag to label the cell membrane.DepositorInsertActin Vhh-sfGFP-P2A-HA-tdiRFP-caax
ExpressionMammalianPromoterCAGGSAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7]K404R
Plasmid#200715PurposeThe plasmid expresses Myc-tagged FBW7 human isoform 1 with Lys404 to Arg mutation. Used for overexpression and detection by western blotting.DepositorInsertFBW7 (FBXW7 Human)
TagsMycExpressionMammalianMutationFBW7 K404 is mutated to Alanine.PromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Nedd1-mOrange2-F75A
Plasmid#196862PurposeExpression of Need1-rCM1 harboring a (F75A) mutation in the rat (r) Centrosomin motif 1 (CM1) and fused to mOrange2. F75A mutatuon renders CM1 incapable of binding and activating gamma-TuRCDepositorInsertNedd1-mOrange2-F75A (Nedd1 Rat)
ExpressionMammalianMutationF75A in the CM1 domainPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCitrine-DNAJC5 L115R
Plasmid#246735PurposeMammalian expression of human DNAJC5 L115R with a mCitrine (YFP) tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsmCitrineExpressionMammalianMutationL115RPromoterCMVAvailable SinceDec. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCitrine-DNAJC5
Plasmid#246733PurposeMammalian expression of human DNAJC5 wildtype with a mCitrine (YFP) tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsmCitrineExpressionMammalianPromoterCMVAvailable SinceDec. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3-GST-Tev-Af1521(K35E/Y145R)-myc
Plasmid#196241PurposeN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site located between the GST tag and Af1521 and a myc tag on the C terminusDepositorInsertN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site between GST and Af1521 encoding a C-terminal myc tag
TagsGST tag and myc tagExpressionBacterialMutationamino acid 35 lysine is replaced with glutamic ac…Available SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-GST-FBW7 alpha
Plasmid#197456PurposeThe plasmid expresses GST-tagged FBW7 human isoform 1. Used for in vitro translation of FBW7alpha.DepositorInsertFBW7 (FBXW7 Human)
UseIn vitro translationTagsGSTExpressionBacterialMutationSee depositor comments belowPromoterT7Available SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXs-IP-mCherry-TOSI
Plasmid#172496PurposemCherry-TOSI (TOr-Signal-Indicator) is a fluorescent reporter for mTORC1 signaling (monitoring PDCD4 degradation) which can be introduced to mammalian cells by retrovirus vector.DepositorAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH-puro/Flag PD-L1 N35/3NQ
Plasmid#121455Purposeexpression of human PD-L1 mutant in mammalian cellsDepositorInsertCD274 (CD274 Human)
UseLentiviralTagsFlagExpressionMammalianMutationN192Q, N200Q and N219QPromoterCMVAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-PCAF (delta5-53a.a.)
Plasmid#65388PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorInsertPCAF (KAT2B Human)
TagsEmGFP and V5ExpressionMammalianMutationlost 13-159bp of the ORFPromoterCMVAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only