We narrowed to 18,567 results for: puro
-
Plasmid#235327PurposePiggyBac integration vector for ComMAND closed-loop circuit regulating mRuby2DepositorInsertmRuby2
UseSynthetic Biology; PiggybacExpressionMammalianPromoterEF1a (human EF1a)Available sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-mRuby2-bGH]-EFS-rtTA-T2A-mGL-P2A-PuroR-WPRE
Plasmid#235268PurposeLentiviral expression of ComMAND base gene regulating mRuby2DepositorInsertmRuby2
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA-BFP
Plasmid#107722PurposeFor expression of sgRNA from the U6 promoter with BFP expression simultaneouslyDepositorTypeEmpty backboneUseCRISPRAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
KL094 - pTRE3G-Flag-Halo-CTCF_WT-BGHpA-CAGGS-rtta3G-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt TIGRE donor
Plasmid#232930PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible Flag-Halo-mCTCF WT, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycin selection.DepositorPublicationInsertFlag-Halo-CTCF WT
UseMouse TargetingExpressionMammalianAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No8
Plasmid#194902PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-8 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.8
UseLentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No6
Plasmid#194900PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-6 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.6
UseLentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No7
Plasmid#194901PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-7 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.7
UseLentiviralExpressionMammalianPromoterU6Available sinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKG2440_pGEEC536_pShip-UbC-mRuby2-P2A-PuroR-bGH
Plasmid#239732PurposePlasmid expressing mRuby2 and PuroR with the UbC promoterDepositorInsertmRuby2-P2A-PuroR
UseSynthetic BiologyAvailable sinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-mTurquoise2-v2-no-scaffold
Plasmid#228522PurposeCROP-seq-puro-v2 with scaffold sequence removed for the insertion of CRISPRmap Opool with guide, scaffold and barcode sequences, using mTurquoise2 as selection markerDepositorInsertmTurquoise2
UseLentiviralAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
px459-AMBRA1 #3
Plasmid#172606PurposeExpresses gRNA #3 against AMBRA1 and Cas9 from S. pyogenes with 2A-PuroDepositorAvailable sinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAU003 - pTRE3G-Cterm_Nterm_switch_CTCF-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156430PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingExpressionMammalianMutationCterm_Nterm_switchedAvailable sinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLentiX1-[TRE3G-TS.FF4x1-mRuby2-bGH]-EFS-rtTA-T2A-mGL-P2A-PuroR-WPRE
Plasmid#235316PurposeLentiviral expression of mRuby2 with 5' microRNA target site only (closed-loop)DepositorInsertmRuby2
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available sinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-TS.FF6x1-mRuby2-bGH]-EFS-rtTA-T2A-mGL-P2A-PuroR-WPRE
Plasmid#235315PurposeLentiviral expression of mRuby2 with 5' microRNA target site only (open-loop)DepositorInsertmRuby2
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-mRuby2-TS.FF6x1-bGH]-EFS-rtTA-T2A-mGL-P2A-PuroR-WPRE
Plasmid#235313PurposeLentiviral expression of mRuby2 with 3' microRNA target site only (open-loop)DepositorInsertmRuby2
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-mRuby2-miRE.FF4-bGH]-EFS-rtTA-T2A-mGL-P2A-PuroR-WPRE
Plasmid#235318PurposeLentiviral expression of mRuby2 with 3' microRNA onlyDepositorInsertmRuby2
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-mRuby2-TS-FF4x1-bGH]-EFS-rtTA-T2A-mGL-P2A-PuroR-WPRE
Plasmid#235314PurposeLentiviral expression of mRuby2 with 3' microRNA target site only (closed-loop)DepositorInsertmRuby2
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-mRuby2(miRE.FF4)-bGH]-EFS-rtTA-T2A-mGL-P2A-PuroR-WPRE
Plasmid#235317PurposeLentiviral expression of mRuby2 with intronic microRNA onlyDepositorInsertmRuby2
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
4 gRNA concatemer
Plasmid#84881PurposeEmpty concatmer vector in which 4 gRNAs can be insertedDepositorTypeEmpty backboneUseRetroviralExpressionMammalianAvailable sinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
sgOPTI:U6-gRNA-CS1-puroR
Plasmid#256351Purposelenti virus vector expressing a Cas9 guide RNA under a human U6 promoter. Contains capture sequence 1 (CS1) in the Cas9 scaffold. Contains puromycin resistance cassette.DepositorInsertsgRNA
UseLentiviralPromoterU6 promoterAvailable sinceJune 22, 2026AvailabilityAcademic Institutions and Nonprofits only