We narrowed to 58,550 results for: tra
-
Plasmid#213718PurposeFor lentiviral expression of shRNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPICEAM7 driven by an hPGK promoter.DepositorInsertEGFP
TagsGSTExpressionMammalianPromoterhPGKAvailable SinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GST-EGFP-GPICEAM7
Plasmid#213723PurposeFor overexpression of a gene, accompanied by the expression of the affinity sorting tag GST-EGFP-GPICEAM7 driven by an SV40 promoter.DepositorInsertEGFP
TagsV5-tag-GSTExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDonor_RB-TnV2_pJEx
Plasmid#213908PurposeBarcoded mariner transposon with crystal violet-inducible outward promoter - barcodes can be added via FseI-SbfI restriction sitesDepositorInsertmariner transposon with kan resistance and EilR/pJEx and FseI-SbfI sites for barcode insertion
ExpressionBacterialAvailable SinceFeb. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYea5.1_C99_sfGFP
Plasmid#207802PurposeYeast 2µ vector for expression of Suc2SP-C99-sfGFP-GAL4DepositorInsertSuc2SP-C100-sfGFP-GAL4 fusion protein
TagsStrep-TagIIExpressionBacterial and YeastAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYea5.1_Notch3_sfGFP
Plasmid#207864PurposeYeast 2µ vector for expression of Suc2SP-Notch3_100-sfGFP-GAL4DepositorInsertSuc2SP-Notch3_100-sfGFP-GAL4 fusion protein
TagsStrep-TagIIExpressionBacterial and YeastAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Hy_pRnrS eGFP SV40
Plasmid#195062PurposeExpresses eGFP mRNA from the Drosophila RnrS promoterDepositorInserteGFP
ExpressionInsectPromoterRnrSAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Hy_pAna eGFP SV40
Plasmid#195063PurposeExpresses eGFP mRNA from the Drosophila Ana promoterDepositorInserteGFP
ExpressionInsectPromoterAnaAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR4 AvrRpm1
Plasmid#209185PurposepENTR4 plasmid with CDS of Pseudomonas syringae pv maculicola type III effector AvrRpm1 without stop codon for C-terminal epitope tagsDepositorInsertAvrRpm1
UseGateway-compatible entry vectorPromoternoneAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPI230
Plasmid#207431PurposeSafe haven knock-in plasmid for the act5 locus for C-terminal mNeonGreen fusionsDepositorInsertC-terminal mNeonGreen
UseUnspecifiedAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPI231
Plasmid#207432PurposeSafe haven knock-in plasmid for the act5 locus for N-terminal mNeonGreen fusionsDepositorInsertN-terminal mNeonGreen
UseUnspecifiedAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-bullfrog saxiphilin
Plasmid#140595Purposeprotein expressionDepositorInsertsaxiphilin bullfrog
TagsGFP-His10ExpressionInsectMutationDeletion of M20 - please see depositor commentPromoterpolyhedrin promoterAvailable SinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKE011
Plasmid#207912PurposeLevel 0 for gRNA in C4 module (5' GCAG-3' TCAG)DepositorInsertpU3-AarI-scaffold-term
UseCRISPRAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS018
Plasmid#207911PurposeLevel 0 for gRNA in C3 module (5' TTCG-3' GCAG)DepositorInsertpU6-AarI-scaffold-term
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS017
Plasmid#207909PurposeLevel 0 for gRNA in C1 module (5' GGCT-3' AGCC)DepositorInsertpU6-AarI-scaffold-term
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS020
Plasmid#207915PurposeLevel 0 for gRNA in D3 module (5' TCCC-3' CTGC)DepositorInsertpU6-AarI-scaffold-term
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKE012
Plasmid#207914PurposeLevel 0 for gRNA in AD2 module (5' TGAC-3' TCCC)DepositorInsertpU3-AarI-scaffold-term
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKE010
Plasmid#207910PurposeLevel 0 for gRNA in C2 module (5' AGCC-3' TTCG)DepositorInsertpU3-AarI-scaffold-term
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS019
Plasmid#207913PurposeLevel 0 for gRNA in D1 module (5' TCAG-3' TGAC)DepositorInsertpU6-AarI-scaffold-term
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/HF-CDC50B
Plasmid#209224PurposeMammalian expression of CDC50BDepositorAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only