We narrowed to 39,223 results for: ANT
-
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13S/sgKras/Cre
Plasmid#99859PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13S mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13A/sgKras/Cre
Plasmid#99855PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13R/sgKras/Cre
Plasmid#99858PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3-SARS2-B.1.617.2
Plasmid#172320Purposeexpressing SARS-CoV-2 B.1.617.2 spike protein (delta strain) for pseudovirus production.DepositorInsertSpike of B.1.617.2 strain (S SARS-CoV-2)
UseTagsExpressionMammalianMutationT19R, 156G, 157-158del, L452R, T478K, D614G, P681…PromoterCMV-FAvailable sinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3-SARS2-B.1.617.1
Plasmid#172319Purposeexpressing SARS-CoV-2 B.1.617.1 (kappa strain) spike protein for pseudovirus productionDepositorInsertSpike of B.1.617.1 strain (S SARS-CoV-2)
UseTagsExpressionMammalianMutationG142D, E154K, L452R, E484Q, D614G, P681R, Q1071H,…PromoterCMVAvailable sinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDmelOR-mRho.V5.mER.hOr47a
Plasmid#126478PurposeHuman codon-optimized D. melanogaster Orco (hOrco) and Or47a (hOr47a). Or47a has N-terminal tags derived from human Rhodopsin (mRho) and HCN1 (mER) for improved trafficking in mammalian cellsDepositorUseTagsH. sapiens HCN1 106VNKFSL111 (mER), H. sapiens Rh…ExpressionMammalianMutationcodon optimization for H. sapiens and codon optim…PromoterCMVAvailable sinceJune 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor smFP-HA (dark) WPRE
Plasmid#131007PurposeMADR donor plasmid for FlpO+Cre- mediated insertion of SM_FP-HA, a cytoplasmic fluorescent protein which includes multiple HA epitope tagsDepositorInsertsmFP-HA WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsHA - 10 total HA epitope tagesExpressionMammalianMutation"dark" variant with GGG fluorphore comp…Promoternone (4x polyA to mitigate episomal expression)Available sinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor smFP-V5 (dark) WPRE
Plasmid#131006PurposeMADR donor plasmid for FlpO+Cre- mediated insertion of a SM_FP-V5, a cytoplasmic fluorescent protein which includes multiple V5 epitope tagsDepositorInsertsmFP-V5 WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsV5 - 10 total of V5 epitope tagExpressionMutation"dark" variant with GGG fluorphore comp…Promoternone (4x polyA to mitigate episomal expression)Available sinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor smFP-Myc (dark) WPRE
Plasmid#130987PurposeMADR donor plasmid for FlpO+Cre- mediated insertion of a SM_FP-Myc, a cytoplasmic fluorescent protein which includes multiple Myc epitope tagsDepositorInsertsmFP-Myc WPRE
UseMosaic analysis for dual recombinase-mediated cas…TagsMyc - 10 total Myc tagsExpressionMutation"dark" variant with GGG fluorophore ver…Promoternone (4x polyA to mitigate episomal expression)Available sinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N MCV ST
Plasmid#37861DepositorInsertMCV ST (MCPyV_gp2 Human Merkel Cell Virus)
UseRetroviralTagsFlag and HAExpressionMammalianMutationPromoterPKGAvailable sinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N HPyV7
Plasmid#37869DepositorUseRetroviralTagsFlag and HAExpressionMammalianMutationPromoterPKGAvailable sinceSept. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N HPyV6
Plasmid#37868DepositorUseRetroviralTagsFlag and HAExpressionMammalianMutationPromoterPKGAvailable sinceAug. 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor smFP-FLAG (dark) WPRE
Plasmid#131005PurposeMADR donor plasmid for FlpO+Cre- mediated insertion of a SM_FP-FLAG, a cytoplasmic fluorescent protein which includes multiple FLAG epitope tagsDepositorInsertsmFP-FLAG WPRE
UseMosaic analysis for dual recombinase-mediated cas…TagsFLAG - 10 total FLAG tagsExpressionMutation"dark" variant with GGG fluorphore comp…Promoternone (4x polyA to mitigate episomal expression)Available sinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-Patchless
Plasmid#194553PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "Patchless" variantDepositorInsertHMGB1 (HMGB1 Human)
UseTagsmEGFPExpressionMammalianMutationK184Rfs*44, truncation by stop codon after Lys209PromoterAvailable sinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-RtoK
Plasmid#194559PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "R > K" variantDepositorInsertHMGB1 (HMGB1 Human)
UseTagsmEGFPExpressionMammalianMutationR > K substitutions after Lys185PromoterAvailable sinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-KtoR
Plasmid#194560PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "K > R" variantDepositorInsertHMGB1 (HMGB1 Human)
UseTagsmEGFPExpressionMammalianMutationK > R substitutions after Lys185PromoterAvailable sinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-TetON-mEGFP-HMGB1-MUT-Patchless
Plasmid#194563PurposeDox-inducible Mammalian Expression of mEGFP-HMGB1 Mutant "Patchless" (K184Rfs*44, "Patchless" variant) Fusion ProteinDepositorInsertHMGB1 (HMGB1 Human)
UseTagsmEGFPExpressionMammalianMutationK184Rfs*44, truncation by stop codon after Lys209PromoterAvailable sinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-Rdel
Plasmid#194556PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "R del" variantDepositorInsertHMGB1 (HMGB1 Human)
UseTagsmEGFPExpressionMammalianMutationDeletion of Arginines after Lys185PromoterAvailable sinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-RorKtoA
Plasmid#194558PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "R or K > A" variantDepositorInsertHMGB1 (HMGB1 Human)
UseTagsmEGFPExpressionMammalianMutationR or K > A substitutions after Lys185PromoterAvailable sinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-RtoA
Plasmid#194557PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "R > A" variantDepositorInsertHMGB1 (HMGB1 Human)
UseTagsmEGFPExpressionMammalianMutationR > A substitutions after Lys185PromoterAvailable sinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGreenII 0000 (No LUC)
Plasmid#44465DepositorTypeEmpty backboneUsePlant transformationTagsExpressionMutationPromoterAvailable sinceMay 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEF 1-E8-4
Plasmid#20090DepositorInsertE8
UseSynthetic Biology; Plant gateway vectorTagsExpressionMutationPromoterAvailable sinceMarch 11, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEF 3-YFP-2
Plasmid#20106DepositorInsertYFP
UseSynthetic Biology; Plant gateway vectorTagsExpressionMutationPromoterAvailable sinceMarch 11, 2009AvailabilityAcademic Institutions and Nonprofits only