We narrowed to 959 results for: Gatc
-
Plasmid#101336Purposetarget site ATCAGATCTACAATGAAGGGCDepositorInsertshRNA targeting miR30
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AksgRNA
Plasmid#121955PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAkCas12b single chimeric gRNA
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA
Plasmid#121954PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA
ExpressionMammalianAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AagRNA
Plasmid#121953PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAaCas12b tracrRNA/crRNA duplex
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-REG1-CDS
Plasmid#136053PurposeREG1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (TATGGGATCAAGTGCCGATTC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM/CBA-eGFP-miRaSyn(human)x3-WPRE-bGHpA
Plasmid#194247PurposeExpresses 3 miRNAs targeting human alpha-SynucleinDepositorAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAM/CBA-eGFP-miRaSyn(mouse)x3-WPRE-bGHpA
Plasmid#194248PurposeExpresses 3 miRNAs targeting mouse alpha-SynucleinDepositorAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-SCR-sgRNA-A
Plasmid#177811PurposeOverexpression of sgRNAs in E. coli HT115 (scrambled targeting sequences)DepositorInsertScrambled sgRNA targeting sequences
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
LEP-shMLL-AF9.643
Plasmid#105565Purposeretrovirally express MLL-AF9 shRNA with puro resistance and GFP markerDepositorInsertshRNA targeting MLL part of MLL-AF9 fusion
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (5'UAG)
Plasmid#170126PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 5' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(5'UAG)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shPRDM14-3
Plasmid#193696PurposeConstitutive lentiviral expression of PRDM14 shRNADepositorInsertPRDM14 (PRDM14 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP472
Plasmid#134997PurposeInterspersed Reporter. Fluorescent reporter to be used with m6A readers and writers. (8xZF binding sites + 14xGATC sites)-pMinCMV-GFPd2-RbGpA pGK-PuroR-T2A-mCh-BGHpA AAVS1 donorDepositorInsertInters. (8XZFBS 14XGATC)-pMinCMV-GFPd2-RbGpA pGK-PuroR-T2A-mCh-BGHpA AAVS1 donor
UseAAV and Synthetic BiologyExpressionMammalianAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP498
Plasmid#134998PurposeClustered Reporter. Fluorescent reporter to be used with m6A readers and writers. (5xZF binding sites + 63xGATC sites)-pMinCMV-GFPd2-RbGpA pGK-PuroR-T2A-mCh-BGHpA AAVS1 donorDepositorInsertClust. (5XZFBS 63XGATC)-pMinCMV-GFPd2-RbGpA pGK-PuroR-T2A-mCh-BGHpA AAVS1 donor
UseAAV and Synthetic BiologyExpressionMammalianAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (3'UAG)
Plasmid#170128PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 3' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(3'UAG)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6Available SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (RAB7A-GAC site)
Plasmid#170140PurposeAAV vector carrying a MS2 adRNA targeting the RAB7A transcriptDepositorInsertMS2-RAB7A(GAC)-MS2
UseAAVExpressionMammalianPromoterHuman U6Available SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
1114H
Plasmid#200640PurposeAn. gambiae transgenesis plasmid. Expresses gRNAs targeting B2-tubulin, ZPG, and DSXF. Crossing to Cas9 generates sterile malesDepositorInsertgRNA targeting DSXF, ZPG, and B2-tubulin. Actin5c-CFP and Vasa2-EYFP reporters.
UseCRISPRExpressionInsectAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDR-nfatc1_sgRNA2
Plasmid#132978Purposenfatc1 sgRNA targeting to "5'-GTGGGAGCTCCATTGGATCG-3" in pDR274DepositorInsertnfatc1 sgRNA2 target sequence
UseCRISPR; Sgrna generation vectorAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only