We narrowed to 2,228 results for: Xpa
-
Plasmid#113850PurposeSuperfolder GFP and tdTomato linked by T2A (APGST linker, -XE)DepositorInsertsfGFP-T2A-tdTomato
ExpressionMammalianAvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-sfGFP-tdTomato T2A -APGST XE
Plasmid#113836PurposeSuperfolder GFP and tdTomato linked by T2A (-APGST linker)DepositorInsertsfGFP-T2A-tdTomato
ExpressionMammalianAvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-sfGFP-tdTomato T2A GST XE
Plasmid#113838PurposeSuperfolder GFP and tdTomato linked by T2A (GST linker)DepositorInsertsfGFP-T2A-tdTomato
ExpressionMammalianAvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-loxP-tdTomato+RbG and HsbG syntrons
Plasmid#172479PurposetdTomato with synthetic introns derived from the rabbit beta-globin gene and the human beta-globin geneDepositorInserttdTomato
UseCre/LoxExpressionMammalianAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-sfGFP-tdTomato long GSA linker E
Plasmid#113855PurposeSuperfolder GFP and tdTomato linked by long GSA linkerDepositorInsertsfGFP-GSA_linker-tdTomato
ExpressionMammalianAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-H2BsfGFP-tdTomato - long GSA linker E
Plasmid#113845PurposeHistone H2B-superfolder GFP and tdTomato linked by long GSA linkerDepositorInsertH2B-sfGFP-GSA_linker-tdTomato
ExpressionMammalianAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-H2BsfGFP-tdTomato - opt GS PQR Var3 P2A -APGST E
Plasmid#113847PurposeHistone H2B-superfolder GFP and tdTomato linked by P2A (-APGST linker)DepositorInsertH2B-sfGFP-P2A-tdTomato
ExpressionMammalianAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-loxP-H2B-sfGFP+pCI syntron-T2A-tdTomato+RbG and HsbG syntrons
Plasmid#172480PurposeH2B-sfGFP with a synthetic intron from the pCI expression vector, T2A, and tdTomato with synthetic introns derived from the rabbit beta-globin gene and the human beta-globin geneDepositorInsertH2B-sfGFP-T2A-tdTomato
UseCre/LoxExpressionMammalianAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
LIR-wtloxP-TRE-CAG-Frt-red-puro-3xPA-Frt-GFP(mVenus)-KrasG12D-cMyc-SV40LT-IRES-KRABoff-PA-TRE-loxP257-RIR
Plasmid#67277Purposeinducbile color change and cancer regulation: FlpO recombinase dependent expression of KrasG12D cMyc and SV40 large T antigen with doxycycline inducible downregulation through tetKRAB system.DepositorInsertsfirst casette contain a red fluorescent protein (katushka) linked to puromycin resitance gene through an E2A site
second cassette contains mVENUS-kras-cmyc-SV40LT-KRABoff
TagsmTQ2 blue fluorescent and red flourescent gene ka…ExpressionMammalianPromoterCAGAvailable SinceAug. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
-
pcDNA3.Flag.HERC2-HECT-WT.6xHis
Plasmid#39227DepositorAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.Flag.HERC2-HECT-C4762A.6xHis
Plasmid#39228DepositorInsertHERC2 HECT Domain (HERC2 Human)
Tags6xHis and FlagExpressionMammalianMutationC4762APromoterT7Available SinceJuly 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MtAcKRS (human-opti)
Plasmid#164195PurposeTo express a Methanosarcina thermophila derived AcKRS in mammalian cells for genetic code expansionDepositorInsertMtAcKRS-478(human-opti)
UseSynthetic BiologyExpressionMammalianMutationD76G; L325M; L329I; Y330F; L333A; C372FPromoterCMVAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MfPylRS (human-opti)
Plasmid#164081PurposeTo express a Methanosarcina flavescens derived PylRS in mammalian cells for genetic code expansionDepositorInsertMfPylRS(human-opti)
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MtPylRS (human-opti)
Plasmid#164080PurposeTo express a Methanosarcina thermophila derived PylRS in mammalian cells for genetic code expansionDepositorInsertMtPylRS-478(human-opti)
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MfBulKRS (human-opti)
Plasmid#164196PurposeTo express a Methanosarcina flavescens derived BulKRS in mammalian cells for genetic code expansionDepositorInsertMf BulKRS(human-opti)
UseSynthetic BiologyExpressionMammalianMutationY269A;Y347FPromoterCMVAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_NESPylRS(AF)_hU6tRNAPyl
Plasmid#223508PurposePylRS (AF)/tRNA Pyl orthogonal pair for genetic code expansion that allows site-specific incorporation of noncanonical amino-acids into a POI using the Amber stop codonDepositorInsertsExpressionMammalianMutationY306A; Y384FPromoterCVM, SP6 and U6Available SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV_NESPylRS(WT)_hU6tRNAPyl
Plasmid#223509PurposePylRS (WT)/tRNA Pyl orthogonal pair for genetic code expansion that allows site-specific incorporation of noncanonical amino-acids into a POI using the Amber stop codonDepositorInsertsExpressionMammalianPromoterCMV, SP6 and U6Available SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only