We narrowed to 712 results for: pgk promoter
-
Plasmid#135669PurposeIntroduce Dox/Cre-inducible (TRE promoter followed by lox-stop-lox) Cas9 cDNA plus Pten-targeting sgRNA into (ES) cells by recombination-mediated cassette exchangeDepositorInsertsgPten
UseMouse TargetingAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVPT-GDNF-tTR-KRAB
Plasmid#11646PurposeTet-regulated (Tet-on) lentiviral vector for GDNF (mPGK promoter) - 2nd generationDepositorAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLVPT-GDNF-rtTR-KRAB-2SM2
Plasmid#11647PurposeTet-regulated (Tet-off) lentiviral vector for GDNF (mPGK promoter) - 2nd generationDepositorAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJH2972
Plasmid#100956PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. URA3MX markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJH2970
Plasmid#100954PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. HIS3MX markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pJH2971
Plasmid#100955PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. KANMX markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
cTRE-PtenWT
Plasmid#135663PurposeIntroduce Dox-inducible (TRE promoter) wildtype Pten cDNA into (ES) cells by recombination-mediated cassette exchangeDepositorInsertPten (Pten Mouse)
UseMouse TargetingAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPL001-BBTK
Plasmid#184751PurposeBig-IN positive control payload encoding EF1a-driven GFP-T2A-BSD. Harbors a backbone counterselectable TK cassette.DepositorInsertpEF1a-eGFP-T2A-BSD-bGHpA
UseCre/Lox, Mouse Targeting, and Synthetic Biology ;…ExpressionMammalianPromoterEF1aAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP185 pLVP-dCas9-DNMT3a V2
Plasmid#100936PurposedCas9 and DNMT WT on C terminus, 4 NLS, driven by pGK promoter, with P2A site and PURO gene, within a lentiviral transfer backboneDepositorInsertdCas9, DNMT3a catalytic domain (DNMT3A S.pyogenes, Human)
UseCRISPR and LentiviralTags3xHA and 3xTy1ExpressionMammalianMutationD10A, H840A for dCas9Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCVhyg-HA-FLAG_Ubc9_WT
Plasmid#164936PurposeExpresses FLAG & HA tagged human uman Ubiquitin Conjugating Enzyme 9 (UBC9) wild type cDNADepositorAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCVhyg-HA-FLAG_Ubc9_C93A
Plasmid#164937PurposeExpresses FLAG & HA tagged human Ubiquitin Conjugating Enzyme 9 (UBC9) _C93A mutant cDNADepositorAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
cTRE-PtenC124S
Plasmid#135664PurposeIntroduce Dox-inducible (TREa promoter) C124S-mutant Pten cDNA into (ES) cells by recombination-mediated cassette exchangeDepositorAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pimEJ5GFP
Plasmid#44026DepositorInsertEJ5GFP egfp-based chromosomal break reporter
ExpressionMammalianMutationpCAGGS promoter and eGFP separated by pgkPURO cas…PromoterpCAGGSAvailable SinceMay 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
bRA89
Plasmid#100950PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. HPH markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
bRA90
Plasmid#100951PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. LEU2 markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
AZ64_pE.DonorCLYBL.TS
Plasmid#199228PurposeDonor plasmid with CLYBL target sites for ITPN or HMEJ knock-in at the human CLYBL safe harbor locusDepositorInsertExpression unit for EGFP reporter
UseGene targeting donor plasmidExpressionMammalianPromoterHuman PGK1 gene promoterAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only