We narrowed to 20,115 results for: IRE;
-
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
drebrin-His
Plasmid#40363DepositorAvailable SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CRY2-mCh-superPLDx30
Plasmid#188988PurposeA lentiviral plasmid encoding CRY2-mCh-superPLDx30 (an engineered PLD mutant with 30 times higher activity than the wild-type)DepositorInsertPLD
TagsCRY2 and mCherryExpressionMammalianMutationK109R, P245A, G328S, G381V, G429DAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-6
Plasmid#172741PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-6; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-6
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSicoR human DGCR8-2
Plasmid#14770DepositorAvailable SinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
Donor-PIGA
Plasmid#153530PurposeUsed as a donor vector for the targeted correction of a mutation in PIGA exon 6DepositorInsertPIGA (a 1,991-bp fragment from intron 5 and exon 6)
UseDonor plasmidTagsN/AMutationNo mutationPromoterNo promoterAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBa.GFP-AP1/gamma1
Plasmid#218801PurposeMammalian expression of mouse Ap1 g1DepositorAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSicoR human Drosha2
Plasmid#14767DepositorAvailable SinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSuper mouse DGCR8-1
Plasmid#14772DepositorAvailable SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCPP5108
Plasmid#128726PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopAA1-2
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5107
Plasmid#128725PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopAA1-1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-PHLPP1(N-terminal truncation)-deltaPH
Plasmid#22930PurposeMammalian expression of a HA tagged, N-terminal truncation of human PHLPP1 containing a deletion of the PH domainDepositorInsertPHLPP1-deltaPH (PHLPP1 Human)
TagsHAExpressionMammalianMutationIncludes 127-1205 aa. Deleted amino-terminal PH d…PromoterCMVAvailable SinceFeb. 3, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET14b PHAS-I
Plasmid#15679DepositorInsertPHAS-I (Eif4ebp1 Rat)
Tags6xHisExpressionBacterialMutationNucleotides 1-354 of rat PHAS-I plus 450bp of 3…Available SinceSept. 24, 2007AvailabilityAcademic Institutions and Nonprofits only -
FAM19A2-V5
Plasmid#184338PurposeExpression of V5-tagged mouse FAM19A2DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAGH42
Plasmid#107249PurposeVipp1-mGFPmut3 (or vipp1-gfp) construct with spectinomycin resistance cassette downstream used to replace the native copy of Vipp1 in Synechocystis (sll0617).DepositorInsertvipp1-gfp
UseSuicide vector for destined for double homologous…TagsmGFPmut3ExpressionBacterialPromoternative promoter of sll0617Available SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-mir124a
Plasmid#61539PurposeExpresses mir124a in mammalian cellsDepositorAvailable SinceJan. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
BPK1179
Plasmid#179296PurposeExpresses dCas9 fused to four DmrA domainsDepositorInsertdCas9-DmrA(x4)
ExpressionMammalianMutationD10A, H840A (catalytically inactive Cas9)PromoterCAGAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJH3626
Plasmid#179630PurposePacr-2(s)::tomm20::miniSOG-SL2::RFP unc-54 3' UTR C.elegans A/B-MN-specific expression of miniSOG-SL2::RFPDepositorAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
C1-FT-mCitrine-EAAARx8-CaaX
Plasmid#155224PurposeMPAct with increased search radiusDepositorInsertF-tractin (aa9-52 of rat ITPKA) fused to mCitrine C-term tagged with codon optimized (EAAAR)x8 and CaaX seq derived from Kras4b
TagsmCitrineExpressionMammalianAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-DUET-GST-eIF4G1-His6, eIF4E
Plasmid#37232DepositorTagsGST and His6ExpressionBacterialPromoterT7Available SinceSept. 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCPP5537
Plasmid#128730PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInsertHopAO1
ExpressionBacterialAvailable SinceJan. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-11
Plasmid#172762PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-11; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-11
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CIBN-CAAX
Plasmid#188989PurposeA lentiviral plasmid encoding plasma membrane-tagged CIBNDepositorAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
p3XFLAG-MKL1-~100
Plasmid#27176DepositorAvailable SinceDec. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCPP5099
Plasmid#128714PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopK1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5328
Plasmid#128721PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopU1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5306
Plasmid#128712PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopH1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5571
Plasmid#128713PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopI1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5539
Plasmid#128728PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopAF1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5618
Plasmid#128709PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopE1
ExpressionBacterialAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only