Skip to main content

We narrowed to 9,951 results for: Uty

Showing: 6021 - 6040 of 9951 results
  1. pcDNA5 rtTA BirA eIF4G +MIC

    Plasmid
    #158790
    Purpose
    pcDNA5 based transfection plasmid for the exogenous expression of N-terminal BirA-Flag-tagged eIF4G1 including the microexon for generation of N2A FlpIn cell lines for BioID
    Depositor
    Insert
    eIF4G1 (with microexon)
    Tags
    3xFlag and BirA*
    Expression
    Mammalian
    Promoter
    miniCMV
    Available Since
    Sept. 9, 2020
    Availability
    Academic Institutions and Nonprofits only
  2. pLKO.1-TRC.mKO2_shARL4C.1

    Plasmid
    #110320
    Purpose
    TRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2
    Insert
    ARL4C (ARL4C Human, Homo sapiens)
    Use
    Lentiviral and RNAi
    Expression
    Mammalian
    Promoter
    RNA polymerase III promoter for human U6 snRNA fo…
    Available Since
    Aug. 20, 2018
    Availability
    Academic Institutions and Nonprofits only
  3. Adeno FT

    Plasmid
    #101824
    Purpose
    Adenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3
    Depositor
    Insert
    U6_sgRNA(Fgfr3)_U6_sgRNA(Tacc3)_CBh_FLAG-Cas9 (Fgfr3, Tacc3 Mouse)
    Use
    Adenoviral
    Tags
    FLAG-Cas9
    Promoter
    U6 and CBh
    Available Since
    Nov. 8, 2017
    Availability
    Academic Institutions and Nonprofits only
  4. pEMS1132

    Plasmid
    #29053
    Purpose
    High copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving an EGFP/Cre fusion reporter
    Depositor
    Insert
    Ple67 (FEV Human)
    Use
    Pleiades promoter project [sic, pleaides plieades]
    Tags
    EGFP-Cre-NLS
    Available Since
    Jan. 9, 2012
    Availability
    Academic Institutions and Nonprofits only
  5. pT/CAGGS-NRASG12V/D38A-IRES-mVenus

    Plasmid
    #236077
    Purpose
    Sleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and a double mutant NRAS (NRASG12VD38A).
    Depositor
    Inserts
    mVenus
    NRAS G12V D38A (NRAS Human)
    Use
    Sleeping beauty transposon plasmid
    Mutation
    G12V D38A
    Promoter
    CAGGS
    Available Since
    May 14, 2025
    Availability
    Academic Institutions and Nonprofits only
  6. Gq-CASE

    Plasmid
    #168125
    Purpose
    Encodes a BRET-based activity sensor for the heterotrimeric G protein Gq. Composed of the subunits G alpha q (GNAQ) tagged with NanoLuciferase, G beta 3 (GNB3) and Venus-tagged G gamma 9 (GNG9).
    Depositor
    Insert
    GNAQ, GNB3, GNG9 (GNAQ, GNB3, GNGT2 Human)
    Use
    Luciferase
    Tags
    cpVenus on GNG9
    Expression
    Mammalian
    Mutation
    NLuc is inserted at F124/E125 within GNAQ
    Available Since
    July 29, 2021
    Availability
    Academic Institutions and Nonprofits only
  7. Gi1-CASE

    Plasmid
    #168120
    Purpose
    Encodes a BRET-based activity sensor for the heterotrimeric G protein Gi1. Composed of the subunits G alpha i1 (GNAI1) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 2 (GNG2).
    Depositor
    Insert
    GNAI1, GNB1, GNG2 (GNB1, GNG2, GNAI1 Human)
    Use
    Luciferase
    Tags
    cpVenus on GNG2
    Expression
    Mammalian
    Mutation
    NLuc is inserted at A121/E122 within GNAI1
    Available Since
    July 29, 2021
    Availability
    Academic Institutions and Nonprofits only
Showing: 6021 - 6040 of 9951 results