We narrowed to 7,455 results for: trac
-
Plasmid#177294Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon/SacB with TcR and LacZDepositorInsertPsacB-sacB
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-Ef1a-SOX17WT-3xFLAG
Plasmid#216198PurposeOverexpress wild-type human SOX17 in HEK 293T cells for use in whole cell extract EMSAsDepositorInsertSOX17 (SOX17 Human)
UseLentiviralMutationGlu113Glu (silent mutation); Glu120Glu (silent mu…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-Ef1a-SOX17E57D-3xFLAG
Plasmid#216199PurposeOverexpress human SOX17E57D in HEK 293T cells for use in whole cell extract EMSAsDepositorInsertSOX17 (SOX17 Human)
UseLentiviralMutationGlu113Glu (silent mutation); Glu120Glu (silent mu…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-Ef1a-SOX17E57P-3xFLAG
Plasmid#216200PurposeOverexpress human SOX17E57P in HEK 293T cells for use in whole cell extract EMSAsDepositorInsertSOX17 (SOX17 Human)
UseLentiviralMutationGlu113Glu (silent mutation); Glu120Glu (silent mu…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-Ef1a-OCT4-3xFLAG
Plasmid#216196PurposeOverexpress human OCT4 in HEK 293T cells for use in whole cell extract EMSAsDepositorInsertOCT4 (POU5F1 Human)
UseLentiviralAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-TRE>hHES3:T2A:EGFP
Plasmid#236630PurposeHygromycin selected lentiviral construct with tetracyclin-inducible human HES3DepositorInsertsUseLentiviralExpressionMammalianMutationCodon optimized based on a variant of wildtype GF…PromoterTREAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pscAAV.T7-SP6-BC(p11-14)-CAG-EGFP-SV40pA-T7
Plasmid#231350PurposeSelf complementary AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses EGFP from CAG promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-mDLX-minBG-CI-mRuby2-W3SL-T7
Plasmid#231352PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from minBG promoter with mDLX enhancer.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-minBG-CI-mRuby2-W3SL-T7
Plasmid#231353PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from minBG promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-SCP1-tdTomato-W3SL-T7
Plasmid#231356PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses tdTomato from SCP1 promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-CMVp-CI-mRuby2-W3SL-T7
Plasmid#231357PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from CMV promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-Ef1s-CI-mRuby2-W3SL-T7
Plasmid#231358PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from Ef1s promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-SCP1-CI-mRuby2-W3SL-T7
Plasmid#231359PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from SCP1 promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-CAG-EGFP-W3SL-T7
Plasmid#231348PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses EGFP from CAG promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
SS-Myc-HexaPro-Foldon (MTK 3a) (pZYW077)
Plasmid#194233PurposeMammalian Toolkit part 3a encoding Jason McClellan lab's 6-proline Spike extracellular domainDepositorInsertCD8a Signal Sequence-Myc Tag-SARS-CoV-2 Spike1-1258 (S Synthetic)
UseSynthetic BiologyPromoterNoneAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Halo-tagged Sox17FNV
Plasmid#206391PurposeExpresses Halo-tagged mouse SOX17FNV in mammalian cells, for single-molecule tracking.DepositorAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.NWS_mCherry-NLS
Plasmid#178282PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.NWS and Nuclear Localization SignalPromotereF1aAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-GST-BTLAicd (AA190-289, Y257F, Y282F)-TwinStrep
Plasmid#180811PurposeExpression of GST fused human BTLA intracellular domain (AA190-289, Y257F, Y282F)-TwinStrepDepositorInsertGST-BTLAint (AA190-289, Y257F, Y282F)-TwinStrep (BTLA Human)
ExpressionBacterialMutationBTLA (Y257F, Y282F)PromoterT7Available SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.S.V5_mCherry-NLS
Plasmid#178281PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNWS.S.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only