We narrowed to 11,999 results for: SHA
-
Plasmid#54575PurposeLocalization: Protein Expression Vector , Excitation: 505, Emission: 515. This plasmid encodes Clover H231L based on reference from Bajar et. al. Sci Rep. 2016.DepositorTypeEmpty backboneTags6xHis and CloverExpressionBacterialAvailable SinceJuly 25, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits
-
A3Bi-Cas9n-UGI
Plasmid#119135PurposeBase editor made from full-length APOBEC3B with an L1 intron to prevent self-restrictionDepositorInsertAPOBEC3B L1 intron-Cas9 nickase-UGI
UseCRISPRMutationL1 intron insertionPromoterCMVAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLN540 (FuGW-G8p-IL12-P2A-CCL21-1Pe)
Plasmid#105201PurposeModule 3 - GAL4 synthetic promoter (with eight binding sites) drives the expression of IL12 and CCL21 transcripts containing miR1-Bs(Pe)DepositorInsertG8p-IL12-P2A-CCL21-1Pe
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceMarch 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-3'UTR
Plasmid#136055PurposeCAPRIN1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCACGTTAGTGTCACAAATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P3nmt1-3HA
Plasmid#39283DepositorInsertnmt1 promoter (nmt1 Fission Yeast)
UseYeast genomic targetingTags3xHA, A. gossypii translation elongation factor 1…Mutation-1163 to +6 of nmt1 locusAvailable SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLEX303 GFP-PIK3C2A
Plasmid#162000PurposeLentiviral expression vector containing PIK3C2A tagged with GFPDepositorAvailable SinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
CFP-FRBx5-His
Plasmid#103784Purposeexpresses His-tagged iPOLYMER component in E. coli for protein purificationDepositorInsertCFP-FRBx5-His
ExpressionBacterialPromoterT7Available SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBAD02_CBASS_Escherichia_coli_703128
Plasmid#224394PurposeFor expression of the type I CBASS system encoded by Escherichia coli 703128DepositorInsertEcCdnD_4TM
ExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD02_CBASS_Escherichia_coli_BWH59
Plasmid#224393PurposeFor expression of the type I CBASS system encoded by Escherichia coli BWH59DepositorInsert2TM_EcCdnD
ExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTagBFP2-Caveolin-C-10
Plasmid#55279PurposeLocalization: Membrane, Excitation: 399, Emission: 456DepositorAvailable SinceOct. 10, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-C2-TetR-KRf-TetR
Plasmid#216270PurposeConstruct 3: TetR - Lipid binding domain KRφ - TetRDepositorInsertTetR - Lipid binding motif (KRf) - TetR
TagsEGFPExpressionMammalianAvailable SinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
YFP-FKBPx5
Plasmid#103775Purposeexpresses iPOLYMER component in mammalian cellsDepositorInsertYFP-FKBPx5
TagsEYFPExpressionMammalianPromoterCMVAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
YFP-FKBPx5-His
Plasmid#103785Purposeexpresses His-tagged iPOLYMER component in E. coli for protein purificationDepositorInsertYFP-FKBPx5-His
TagsEYFP, His-tagExpressionBacterialPromoterT7Available SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcdna3 Flag Jip2
Plasmid#59027Purposeact as molecular scaffolds that mediate the activation of the JNK signaling pathway in vivo.DepositorInsertmitogen-activated protein kinase 8 interacting protein 2 (MAPK8IP2 )
TagsFlagExpressionMammalianAvailable SinceSept. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_version2_U6_AtPDS3_gRNA10
Plasmid#197952PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter, with SV40 NLS at the C-terminal , and the AtPDS3 guide RNA 10 driven by U6 promoter.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterAtU6-26 and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-H2B-C-10
Plasmid#54112PurposeLocalization: Nucleus/Histones, Excitation: 487, Emission: 509DepositorInsertH2B (H2BC11 Human)
TagsmEmeraldExpressionMammalianMutationD26G and V119I in H2BPromoterCMVAvailable SinceJune 16, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMM9-MAPKK2-WT
Plasmid#40805DepositorAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJG85
Plasmid#89281PurposeEntry vector containing the TaU6 promoter and an Esp3I Golden Gate cloning site for cloning of the sgRNA, all between attL5 and attL2 sitesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
px552-sg-gria1-HT-SEP
Plasmid#187653PurposeContains HaloTag-SEP to be inserted into the NTD of Gria1 (via HITI) and single guide RNA to target Cas9 to Gria1 under control of the U6 promoter.DepositorInsertHaloTag-SEP donor
UseAAV and CRISPRTagsN/APromoterN/AAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only