We narrowed to 9,085 results for: mel
-
Plasmid#239044PurposeOverexpression of alpha-MSHDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only
-
AAV-DIO-beta-Endorphin
Plasmid#239043PurposeOverexpression of beta endorphinDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRpuro-sgSEC24C #2
Plasmid#231564PurposepLentiCRISPR expression vector for Cas9 and gRNA targeting human SEC24C (#2) (Puromycin selection marker)DepositorAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRpuro-sgSEC24C #1
Plasmid#231563PurposepLentiCRISPR expression vector for Cas9 and gRNA targeting human SEC24C (#1) (Puromycin selection marker)DepositorAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLJC2-DHFR-3xFLAG
Plasmid#217428PurposeLentiviral overexpression of human DHFRDepositorInsertDHFR (DHFR Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert sequence is a codon-optimized gBLOCK (IDT)PromoterCMVAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgABCC4_1
Plasmid#217433PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human ABCC4DepositorInsertsgRNA 1 targeting ABCC4 (ABCC4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgABCC4_3
Plasmid#217434PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human ABCC4DepositorInsertsgRNA 3 targeting ABCC4 (ABCC4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
ENTR_BN001T-N_START
Plasmid#218058PurposeRESOLUTE SLC binder cloning plasmidDepositorInsertBN001T-N_START
UseCloning plasmidAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
ENTR_BN006A-P_START
Plasmid#218059PurposeRESOLUTE SLC binder cloning plasmidDepositorInsertBN006A-P_START
UseCloning plasmidAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
ENTR_BN001M-T_START
Plasmid#218060PurposeRESOLUTE SLC binder cloning plasmidDepositorInsertBN001M-T_START
UseCloning plasmidAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-SRRD-V5-APEX2 (in pLEX_307)
Plasmid#214921Purposeconstitutive expression of SRRD fused to V5 and APEX2 - used for APEX2 proximity biotinylationDepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-Zebrafish IntS6
Plasmid#198410PurposeExpresses FLAG-tagged zebrafish IntS6DepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-Zebrafish IntS6L
Plasmid#198411PurposeExpresses FLAG-tagged zebrafish IntS6LDepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
p Pcrg1: Khd4-Ada-Gfp (CbxR)
Plasmid#203734PurposePlasmid for ectopic integration and expression of Khd4-Ada-Gfp. The 4282 bp khd4-ORF is fused C-terminally to the 1200 bp adar catalytic domain (Ada) with three repeats of GGGGS linker in between, folDepositorInsertKhd4-Ada-Gfp
TagsGfpExpressionBacterialPromoterPcrg1Available SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 exon
Plasmid#176033PurposeA vector for the CRISPR-Cas9 system targeting an exon of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 intron
Plasmid#176224PurposeA vector for the CRISPR-Cas9 system targeting an intron of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-Duet1-6xHis-TEV-NDP52
Plasmid#190194PurposePlasmid for the protein expression of 6xHis-TEV-NDP52 in a bacterial expression system. Internal reference: SMC401DepositorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2z-lmo2
Plasmid#164657Purposefor the synthesis of zebrafish lmo2 mRNADepositorAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-SopB(K525A)
Plasmid#183659PurposeN-terminally tagged Salmonella Typhimurium SopB (K525A) for mammalian expressionDepositorInsertsopB (sopB Salmonella enterica serovar Typhimurium)
TagsEGFPExpressionMammalianMutationK525APromoterCMVAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only