We narrowed to 15,073 results for: NTS;
-
Plasmid#133235PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with NoP (pOGG113), gusA (pOGG083) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPS0386
Plasmid#133236PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with NoP (pOGG113), celB (pOGG050) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPS0383
Plasmid#133233PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with NoP (pOGG113), sfGFP (pOGG037) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pEN-R2-mCsfGFP-L3
Plasmid#178602PurposeIt can be used to study protein turnover in living plant cells of Arabidopsis (Arabidopsis thaliana) and Nicotiana benthamiana.DepositorInsertTandem fluorescent protein timers (tFTs)
UseEntry vector for gateway cloningTagsmCherry superfolder GFPAvailable SinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSADdeltaG-GFP-AlstR
Plasmid#32647DepositorAvailable SinceNov. 3, 2011AvailabilityAcademic Institutions and Nonprofits only -
prNFL-Q333P-EGFP
Plasmid#132602PurposeExpresses EGFP-tagged rat NFL containing the Charcot-Marie-Tooth disease type 2E Q333P mutationDepositorInsertNefl (Nefl Rat)
TagsEGFPExpressionMammalianMutation998A>C, 999G>C; Gln333ProPromoterCMVAvailable SinceNov. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
PKG I beta CAT
Plasmid#16396DepositorAvailable SinceApril 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAT15485_Hypa-ABE8e
Plasmid#174123PurposeExpresses ABE8e fused with Hypa-SpCas9DepositorInsertHypa-ABE8e
UseCRISPRTagsNucleoplasmin NLS and SV40 NLSExpressionMammalianPromoterEF1-aAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
FusionRed-PlastinC-10
Plasmid#56130PurposeLocalization: Cytoskeleton, Excitation: 580, Emission: 608DepositorAvailable SinceApril 1, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMOD_A1810
Plasmid#91040PurposeModule A, Promoter: ZmUbi, Gene: Csy4-P2A-TaCas9_dead (D10A + H840A), Terminator: HSPDepositorInsertCsy4-P2A-TaCas9_dead (D10A + H840A)
UseCRISPRMutationD10A, H840APromoterZmUbiAvailable SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
KHBD00606
Plasmid#39684DepositorAvailable SinceSept. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf137
Plasmid#12825PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf137
ExpressionMammalianAvailable SinceDec. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
pmalc4x_I499F_TEV
Plasmid#47703PurposeExpresses MBP myocilin olfactomedin domain fusion protein with a TEV protease recognition sequence and the mutation I499FDepositorInsertOlfactomedin-like domain with I499F mutation (MYOC Human)
TagsMBPExpressionBacterialMutationchanged I499FPromoterPtacAvailable SinceSept. 9, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
phNFL-E396K
Plasmid#132595PurposeExpresses human NFL containing the Charcot-Marie-Tooth disease type 2E E396K mutationDepositorAvailable SinceNov. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_E
Plasmid#72624PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEE495
Plasmid#149291PurposeT-DNA encoding TRV2 with direct repeat multiplexed truncated FT augmented gRNAs targeting NbAGsgRNA1, NbPDS3, NbAGsgRNA2DepositorInsertp35S:TRV2_Direct_NbAGsgRNA1_NbPDS3sgRNA_NbAGsgRNA2_TrunFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A0608
Plasmid#91018PurposeModule A, Promoter: EC1.2, Gene: Csy4-P2A-AtCas9_D10A nickase, Terminator: HSPDepositorInsertCsy4-P2A-AtCas9_D10A nickase
UseCRISPRMutationD10APromoterEC1.2Available SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSET FLIPglu-600uDelta11 Aphrodite
Plasmid#13569DepositorInsertFLIPglu F16A Delta11 Aphrodite
TagsAphrodite and ECFPExpressionBacterialMutationFluorophore-derived linker shortened. F16A mutati…Available SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only