We narrowed to 16,371 results for: grna
-
Plasmid#196990PurposeDerived from pLV hU6-sgRNA Nestin-dCas9-KRAB-T2a-GFP with KDR sgRNADepositorInsertVEGFR2
UseCRISPR and LentiviralAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-TadA8e-SpN aa2-713- inteinN-U6-Camk2d sgRNA7
Plasmid#226915PurposeExpresses TadA8e and Sp cas9N by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, TadA, nSp Cas9N, inteinN
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-HA-TadA8e-Sauri N aa1-438-inteinN-U6-Camk2d sgRNA7
Plasmid#226678PurposeExpresses TadA8e and Sauri cas9N by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, TadA, nSauri Cas9N, inteinN
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBBK02 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitKanR, AmpR)
Plasmid#178986PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK10 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitURA3,AmpR)
Plasmid#178994PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitURA3DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK08 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitLEU2,AmpR)
Plasmid#178992PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitLEU2DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK06 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitNatR,AmpR)
Plasmid#178990PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitNourseothrycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW188-lenti-spsgRNA-lacZ-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#170813PurposeLentiviral vector to co-express a lacZ control spsgRNA with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR
UseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LB001: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#2 gRNA
Plasmid#131757PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 Sp/xCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LA901: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#1 gRNA
Plasmid#131756PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 Sp/xCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
JV201: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#1 gRNA
Plasmid#131755PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 SaCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LB101: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#2 gRNA
Plasmid#131758PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 SaCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
Plasmid#61591PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianAvailable SinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX602-AAV-TBG::NLS-SaCas9-NLS-HA-OLLAS-bGHpA;U6::BsaI-sgRNA
Plasmid#61593PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTagsHA, NLS, and OLLAS tagExpressionMammalianMutationK175R and K736R (deUb mutations)Available SinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLQ9834_sgBB: pHR-hU6-CasMINI sgRNA_#2; EF1a-Puro-T2A-BFP- WPRE
Plasmid#180280PurposeThe CasMINI sgRNA cloning backbone with sites 'BsmBI' for inserting new guide sequences.DepositorInsertCasMINI sgRNA (backbone) and BFP
UseLentiviralExpressionMammalianPromoterU6Available SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR
Plasmid#60231PurposeExpresses Cre recombinase and KASH-tagged EGFP from the hSyn promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.DepositorInsertssgRNA
Cre recombinase
EGFP
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HA-P2A and EGFP-KASHExpressionMammalianPromoterU6 and hSynAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCBh_3x Flag-NLS-denOsCas12f1-NLS-VPR-NLS-mCherry_pA_phU6_gRNA scaffold-spacer_pCMV_BFP_pA
Plasmid#197031PurposeVector encoding a human codon-optimized dead enOsCas12f1 (denOsCas12f1)-VPR driven by CBh promoter, guide RNAs compatible with enOsCas12f1 driven by hU6, and BFP driven by CMV promoterDepositorInserthumanized denOsCas12f1-VPR
ExpressionMammalianMutationD52R / T132R / D228A / D406APromoterCBh, CMV, hU6Available SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only