We narrowed to 4,449 results for: Mcc
-
Plasmid#199577PurposeExpresses helicase dead DDX5 cloned into pLenti puroDepositorAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only
-
TRE-eGFP-F1C
Plasmid#211457PurposeDox inducible delivery of eGFP fused to a flotillin-1 palmitoylation blocking peptide (F1C)DepositorInsertFlotillin-1-palmitoylation blocking peptide (FLOT1 Human)
UseLentiviralTagseGFPExpressionMammalianMutationNoneAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-eGFP-F1A
Plasmid#211458PurposeDox inducible delivery of eGFP fused to a flotillin-1 palmitoylation mutant control peptide (F1A)DepositorInsertFlotillin-1-palmitoylation mutant control peptide (FLOT1 Human)
UseLentiviralTagseGFPExpressionMammalianMutationC34AAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBS NL4-3 envFS eGFP 5'CMV Δtat
Plasmid#101347Purposetat ATG->ACG (silent in vpr reading frame), nt 78 mutated T->G to change Tyr to stop codon, nt 116 mutated T->C to disrupt Met, 5'LTR replaced with CMV-R-U5 from pALPS for tat-independent transcription in HEK293E cells.DepositorInsertNL4-3
UseLentiviralMutationdelta TatAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
-962 human cyclin D1 promoter TCF (1)-(4) sites mutant pGL3Basic
Plasmid#32736DepositorInsertCCND1 Promoter (CCND1 Human)
UseLuciferaseMutation-75 TCF(1) and -68 TCF(2) CTTTGATCTTTGCT deletion…Promoter-962 CCND1Available SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pWHI2-NAT
Plasmid#80588PurposeCEN plasmid expressing full-length WHI2 from S.cerevisiae S288C background under its native promoterDepositorAvailable SinceJuly 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-zeo G226A ORF29
Plasmid#200024PurposeLentiviral vector for expression of KSHV ORF29 with G226A mutationDepositorInsertORF29
UseLentiviralMutationGlycine 226 changed to alaninePromoterCMVAvailable SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-zeo E321K ORF29
Plasmid#200025PurposeLentiviral vector for expression of KSHV ORF29 with E321K mutationDepositorInsertORF29
UseLentiviralMutationGlutamic acid 321 changed to lysinePromoterCMVAvailable SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-zeo D476A ORF29
Plasmid#200027PurposeLentiviral vector for expression of KSHV ORF29 with D476A mutationDepositorInsertORF29
UseLentiviralMutationAspartic acid 476 changed to AlaninePromoterCMVAvailable SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWHI2-HYG
Plasmid#80589PurposeCEN plasmid expressing full-length WHI2 from S.cerevisiae S288C background under its native promoterDepositorAvailable SinceJuly 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-gRNA hUbC-VP64-dSaCas9-VP64-T2A-Thy1.1
Plasmid#194279PurposeExpresses gRNA and VP64-dSaCas9-VP64 from lentiviral vectorDepositorInsertshumanized VP64 dSaCas9 VP64 T2A Thy1.1
gRNA
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhU6 and hUbCAvailable SinceFeb. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAIP hIL4 co
Plasmid#74169PurposeLentiviral vector for expression of human codon optimized IL4 with puromycin resistance.DepositorAvailable SinceJune 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
StrKDEL-IRES-ManII-mScarlet-i
Plasmid#117274PurposeExpresses an Str-KDEL Hook for the RUSH system and separately mannosidase II-mScarlet-iDepositorInsertsTagsmScarlet-iExpressionMammalianMutationcontains only amino acids 1 to 116 of ManIIPromoterCMV and IRESAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pStr-KDEL-IRES-ST-mCherry
Plasmid#110727PurposeExpresses an Str-KDEL Hook for the RUSH system and separately Sialyltransferase-mCherryDepositorInsertsTagsStr Streptavidin binding peptide (SBP) and mCherr…ExpressionMammalianMutationcontains only amino acids 1 to 43 of STPromoterCMV and IRESAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
GST-CHMP4C (216-233) (pGEX2T(TEV))
Plasmid#80635PurposeResidues 216-233 of CHMP4C; Bacterial Expression Vector; TEV-cleavable GST tag; Sundquist Lab Internal ID: WISP06-202DepositorAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-zeo G226A E321K ORF29
Plasmid#200026PurposeLentiviral vector for expression of KSHV ORF29 with G226A and E321K mutationDepositorInsertORF29
UseLentiviralMutationGlycine 226 changed to alanine, glutamic acid 321…PromoterCMVAvailable SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
GST-CHMP4A (205-222) (pGEX2T(TEV))
Plasmid#80633PurposeResidues 205-222 of CHMP4A, Bacterial Expression Vector; TEV-cleavable GST tag; Sundquist Lab Internal ID: WISP06-60DepositorAvailable SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSCGB3A2_HL-P2A-TagBFP-PGK-NeoR-SCGB3A2_HR
Plasmid#126697Purposedonor vector for targeting a 2A peptide followed by blue fluorescent reporter to the human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertTagBFP
ExpressionMammalianAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
ExpressionMammalianPromoterHuman U6Available SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only