We narrowed to 8,980 results for: sgRNA
-
Plasmid#133763PurposeExpresses Cas9 and human TDP-43 sgRNADepositorAvailable SinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pSCAR_sgRNA_hygro-tagBFP-lox5171
Plasmid#162070Purpose3rd generation lentivirus sgRNA delivery backbone with Cre-removable tagBFP reporter and hygromycin resistanceDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDY1623 NOLC1 sgRNA 2
Plasmid#234834PurposesgRNA 2 for NOLC1 STITCHR insertionDepositorInsertNOLC1 sgRNA (NOLC1 Human)
UseCRISPRAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-SCR-sgRNA-A
Plasmid#177811PurposeOverexpression of sgRNAs in E. coli HT115 (scrambled targeting sequences)DepositorInsertScrambled sgRNA targeting sequences
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14103 aeBlue-targeting_sgRNA
Plasmid#239750Purposeguide for aeBlueDepositorInsertguide targeting aeBlue
UseCRISPR; Cell-free system using bacterial extractExpressionBacterialPromoterJ23119Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 2
Plasmid#51761PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 2
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEJS1096 Dual-sgRNA.Design 1
Plasmid#159538PurposeDelivery of dual sgRNA cassettes and Nme2Cas9 in a single AAV vectorDepositorInsertNme2Cas9 nuclease with two guide RNA cassettes with promoters
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianPromoterU1aAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-ANLN_sgRNA
Plasmid#183874PurposepX459V2.0-HypaCas9 plasmid with ANLN sgRNA for N-terminal tagging of anillin in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-sgRNA-BFP-Puro
Plasmid#229013PurposePerturb Seq sgRNA vector with PiggyBac backboneDepositorTypeEmpty backboneExpressionMammalianAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAT9658-sgRNA-mCherry
Plasmid#162987PurposesgRNA cloning plasmidDepositorInsertexchangeable cassette
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
p-mCherry2-sgRNA (empty)
Plasmid#198330PurposeCustomisable sgRNA sequence with optimised sgRNA scaffold for expression under U6 promoter, with mCherry2 reporterDepositorInsertU6-sgRNA(F+E) empty
ExpressionMammalianPromoterU6Available SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCAR_sgRNA_puro-mKate-lox5171
Plasmid#162077Purpose3rd generation lentivirus sgRNA delivery backbone with Cre-removable mKate2 reporter and puromycin resistanceDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDT-sgRNA-XMAS-1x
Plasmid#164413PurposeDual targeted guide and cloning vector. Targets pEF-XMAS-1xStop. Guides targeting endogenous sites can be cloned into BbsI sites.DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-AAVS1_sgRNA
Plasmid#183891PurposepX459V2.0-HypaCas9 plasmid with sgRNA targeting the AAVS1 in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDN-Cherry-sgRNA
Plasmid#221387Purposeepisomal (HygR), with constitutive mCherry (Psmyc) and AHT-inducible sgRNA cloning site, including Golden Gate for multiple sgRNAsDepositorInsertnone, cloning vector for introduction of targeting sequences
UseCRISPRAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCAR_sgRNA_hygro-tagBFP-lox2272
Plasmid#162078Purpose3rd generation lentivirus sgRNA delivery backbone with Cre-removable tagBFP reporter and hygromycin resistanceDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-A
Plasmid#177786PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHelper-CBE-sgRNA
Plasmid#221137PurposeHelper plasmid for sgRNA cloning for CRISPR-Cas9 cytosine base editing. sgRNA-scaffold with Cas9 handle expressed from constitutive bacterial promoter J23119(SpeI). 2 BbsI sites for sgRNA cloning.DepositorInsertsgRNA-scaffold with Cas9 handle
UseCRISPRExpressionBacterialPromoterJ23119(SpeI)Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWH1266-Apra-sgRNA
Plasmid#218372PurposesgRNA expression plasmid for CRISPR-intereferenceDepositorInsertsgRNA expression cassette
UseCRISPRExpressionBacterialPromoterJ23119Available SinceMay 2, 2024AvailabilityAcademic Institutions and Nonprofits only