We narrowed to 918 results for: tac promoter
-
Plasmid#239942PurposeAtACT2 promoter driving the expression of dCas9-ZAT10(2x)DepositorInsertAtACT2::dCas9-ZAT10(2x)
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationN/APromoterAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 4 CMV mTagBFP
Plasmid#206279PurposeENTR Vector 4 for MultiSite Gateway assembly. Encodes mTagBFP under the control of a CMV promoter.DepositorInsertmTagBFP
UseMultimate/gateway entr 4TagsExpressionMammalianMutationPromoterAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLViP-LifeAct-iRFP670
Plasmid#229699PurposeLentiviral expression of LifeAct-iRFP670 in mammalian cellsDepositorInsertSynthetic construct LifeAct-mTurquoise gene
UseLentiviralTagsiRFP670ExpressionMammalianMutationPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorInsertd5-HT1AR gRNA (5-HT1A Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLViP-LifeAct-TagRFPT
Plasmid#229700PurposeLentiviral expression of LifeAct-TagRFPT in mammalian cellsDepositorInsertSynthetic construct LifeAct-mTurquoise gene
UseLentiviralTagsTagRFPTExpressionMammalianMutationPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBQ10:LYK5_At-3xHA
Plasmid#202192PurposeExpress Arabidopsis thaliana LYK5 gene under UBQ10 promoterDepositorInsertLYSM-CONTAINING RECEPTOR-LIKE KINASE 5 (LYK5 Mustard Weed)
UseTagsHAExpressionPlantMutationPromoterAtUBQ10Available SinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
61427-sgHtt_10
Plasmid#157861PurposeExpresses a sgRNA targeting mouse Htt promoter for gene activation using the SAM systemDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Puro-EF-1α>{H2B-RFP}
Plasmid#201121PurposeRFP expression in cells under EF-1α promoter; cytoplasmic and histone-bound, nuclearDepositorInsertH2B-RFP
UseLentiviralTagsExpressionMutationNoPromoterAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pICSL11060
Plasmid#68264PurposeLevel 1 Golden Gate Cassette: Cas9 expression cassette for plants (exemplified in Brassica oleracea)DepositorInsertPromoter/5UTR: CsVMV+ CDS:SpCas9 + 3UTR/terminator:35s
UseSynthetic BiologyTagsExpressionPlantMutationPromoterAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-L858R-T790M-dual-nick sgRNA
Plasmid#214101PurposeLentiviral vector expressing nicking sgRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two sgRNAs using independent U6 promoters.DepositorInsertEGFR L858R nicking sgRNA/EGFR T790M nicking sgRNA
UseLentiviralTagsExpressionMammalianMutationPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPN260
Plasmid#91581PurposeExpress sgRNA targeting human CLUDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mIDUA)
Plasmid#170123PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse IDUA mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Idua Mouse)
UseAAVTagsExpressionMammalianMutationPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBL132
Plasmid#104333PurposeExpresses taz from a LacI regulated promoter under inducible IPTG control.DepositorInsertTaz
UseTagsExpressionBacterialMutationPromoterPtacIAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEMS1260
Plasmid#29132PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorInsertPle214 (TAC1 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1263
Plasmid#29135PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorInsertPle217 (TAC1 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable SinceOct. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1183
Plasmid#29095PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorInsertPle220 (TAC3 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable SinceFeb. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1184
Plasmid#29096PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorInsertPle221 (TAC3 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable SinceNov. 29, 2011AvailabilityAcademic Institutions and Nonprofits only