We narrowed to 10,454 results for: ESP
-
Plasmid#18076DepositorInsertDystrophin (DMD Human)
TagsGSTExpressionBacterialMutationSecond conserved Tryptophan (W) of the WW domain …Available SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2TK-WW-CR-W3083F/P3086A
Plasmid#18077DepositorInsertDystrophin (DMD Human)
TagsGSTExpressionBacterialMutationSecond conserved Tryptophan (W) of the WW domain …Available SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2TK-WW-CR-d-ZZ-W3083F
Plasmid#18078DepositorInsertDystrophin (DMD Human)
TagsGSTExpressionBacterialMutationSecond conserved Tryptophan (W) of the WW domain …Available SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2TK-WW-CR-d-ZZ-W3083F/P3086A
Plasmid#18079DepositorInsertDystrophin (DMD Human)
TagsGSTExpressionBacterialMutationSecond conserved Tryptophan (W) of the WW domain …Available SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pET28aAviHisCD72aCTLD
Plasmid#129065Purposegeneration of biotinylated mouse CD72a CTLD protein using bacteriaDepositorInsertCD72a (Cd72 Mouse)
ExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
pLHCX-XBP1 mNeonGreen NLS
Plasmid#115971PurposeER-stress sensor - XBP1 splicing fluorescent reporter with mNeonGreen (retroviral vector backbone)DepositorInsertX-box binding protein 1 (XBP1 Synthetic, Human)
UseRetroviralTagsHA tag, c-myc NLS, and mNeonGreenExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_GR-RE_MLPmin_BC1094-luc2
Plasmid#227114PurposeGlucocorticoid receptor response element for luciferase and barcode assays; barcode BC1094DepositorInsert12x clustered GR response element linked to MLP minimal promoter driving barcode 1094 and a luciferase reporter gene
UseAAVExpressionMammalianAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV2-SEP-GluA1 (M1)
Plasmid#64942Purposemammalian expression of rat GluA1DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
SpySwitch
Plasmid#184225PurposeExpresses SpySwitch in the bacterial cytoplasm. SpySwitch binds SpyTag-, SpyTag002- or SpyTag003-fusions non-covalently for affinity purification, allowing gentle pH or temperature release.DepositorInsertSpySwitch
TagsHis6ExpressionBacterialMutationE77A mutation prevents isopeptide bond formation,…PromoterT7Available SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
mcherry-DN KASH
Plasmid#125553Purposemcherry labeled DN-KASHDepositorInsertSYNE1 (SYNE1 Human)
TagsmcherryExpressionMammalianMutationTruncated form: only the KASH domain of nesprin-…PromoterCMVAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-ASAP5-WPRE
Plasmid#225709PurposePan-neuronal, pan-membrane expression of the genetically encoded voltage indicator ASAP5; can be used for dendritic voltage imagingDepositorInsertASAP5
UseAAVPromoterhuman synapsinAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Myc-AIM2
Plasmid#73958PurposeExpress c-Myc-tagged human AIM2 in mammalian cellsDepositorAvailable SinceApril 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-ASAP5-Kv2.1-WPRE
Plasmid#225707PurposePan-neuronal soma-targeted expression of the genetically encoded voltage indicator ASAP5DepositorHas ServiceAAV1InsertASAP5-Kv2.1
UseAAVPromoterhuman synapsinAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.27_ARE/NRF2-SPE
Plasmid#177775PurposeLuciferase reporter for ARE/NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseLuciferaseAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-BHLHE40
Plasmid#110154PurposeExpression of human BHLHE40 in mammalian cellsDepositorInsertBHLHE40 (basic helix-loop-helix family member e40) (BHLHE40 Human)
TagsHAExpressionMammalianPromoterCMVAvailable SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1 hSCN5A
Plasmid#145374Purposeexpresses human Nav1.5 (WT) in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAc-C Med12His
Plasmid#49240Purposeexpresses human Med12 with His tag in insect cellsDepositorAvailable SinceNov. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-EXO1a
Plasmid#111629PurposeExpresses human WT Exonuclease 1a (EXO1a) tagged with mCherry in mammalian cellsDepositorAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBItetDT240GFP
Plasmid#96904Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 240 interrupted CTG repeats in exon 15 locatedDepositorInsertEGFP and human DMPK exons 11-15 with 240 interrupted CTG repeats (DMPK Human)
UseTetracycline responsive and bidirectionalExpressionMammalianPromotertetracycline responsive and bidirectionalAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only