We narrowed to 9,386 results for: BLI
-
Plasmid#83183PurposeGateway ORF Entry clone of human HRAS [NM_005343.2 ] with stop codon (for native or N-terminal fusions), G12D mutationDepositorAvailable SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only
-
Hs.NRAS Q61K
Plasmid#83180PurposeGateway ORF Entry clone of human NRAS [NM_002524.4 ] with stop codon (for native or N-terminal fusions), Q61K mutationDepositorAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
NEK2
Plasmid#39163PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-CTSB
Plasmid#158443PurposeGateway Cloning compatible entry vector for the human CTSB gene.DepositorInsertCTSB (CTSB Human)
UseGateway entry vectorAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-DIO-EF1a-TVA-P2A-EYFP
Plasmid#177017PurposeFor expression of the avian TVA receptor in a cre-dependent mannerDepositorInsertTVA-P2A-EYFP (CD320 Coturnix japonica)
UseAAV and Cre/LoxTagsEYFPExpressionMammalianPromoterCAGGSAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-cytoMetGFP
Plasmid#37561DepositorInsertMET (MET Human)
UseLentiviralTagsGFPExpressionMammalianMutationonly contains cytoplasmic domain amino acids K956…PromoterCMVAvailable SinceAug. 7, 2012AvailabilityAcademic Institutions and Nonprofits only -
hSRF-3xHA-IRES-hrGFP (#479)
Plasmid#78347PurposeOverexpression of human SRF ORF with a 3xHA C-terminal tag and an IRES-hrGFP reporterDepositorAvailable SinceJuly 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMT-TAK1-V5-His
Plasmid#63753PurposeExpresses drosophila TAK1 tagged with V5 and 6xHis epitopes, under control of metallothionein promoterDepositorAvailable SinceApril 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn 2xLyn-ERex-mKate2-bPAC(F198Y)
Plasmid#219654PurposeNeuronal expression of PACmn with mKate2, a membrane targeted version of the photoactivatable adenylyl cyclase from Beggiatoa with lowered dark activity.DepositorInsert2xLyn-ERex-mKate2-bPAC(F198Y)
UseAAVTagsER exit ( FCYENE) and Lyn11 (GCIKSKGKDS)ExpressionMammalianPromoterSynAvailable SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
ACE2 g3
Plasmid#153013PurposeA guide RNA targeting ACE2 in a lentiviral plasmid co-expressing mCherryDepositorAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
MARS
Plasmid#205232PurposeExpresses PLEKHA5 aa 143-271 (K163A and R164A) fused to mScarlet-i in mammalian cellsDepositorInsertPLEKHA5 aa 143-271 with K163A and R164A mutations (PLEKHA5 Human)
TagsNuclear Export Sequence and mScarlet-iExpressionMammalianMutationamino acids 143-271 of PLEKHA5 (GenBank reference…PromoterCMVAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
K560GFP_17NL
Plasmid#129767PurposeExpresses Drosophila Kinesin-1 with extended neck linker (DAL insert) truncated at 560 and GFP tagged for motility assaysDepositorAvailable SinceNov. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-L3US2-RFP-HDAC3
Plasmid#83966PurposeLentiviral CRISPR HDAC3 dual gRNA targeting vectorDepositorAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pES133
Plasmid#127552PurposeVariant of pKD13. Lambda Red recombineering PCR template plasmid carrying an F5-tetA-F5 cassette orthogonal to FRT-KanR-FRT in pKD13DepositorInsertF5-flanked tetracycline resistance cassette
ExpressionBacterialMutationMultiple SNPs in tetA (originally from pBR322) to…Available SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAG416-GAL-hnRNPA1
Plasmid#181710PurposeGalactose inducible expression of hnRNPA1DepositorInserthnRNPA1 (HNRNPA1 Human)
ExpressionYeastAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR CDS
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
HPGD
Plasmid#39154PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shGAC
Plasmid#110423PurposeshGAC, silence glutaminase GAC isoform, doxycycline inducible, puromycin selectionDepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
isoform PKC Iota (JCE597)
Plasmid#182030Purposeyeast expression of mouse PKC Iota with yeast PKC1 promoter and ADH1 terminatorDepositorAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only