We narrowed to 9,676 results for: control
-
Plasmid#46815PurposeTEF1 and PGK1 promoter controlled expression cassettes with G418 resistance for yeast transformationDepositorTypeEmpty backboneTagsFLAG and c-mycExpressionYeastPromoterTEF1 and PGK1Available SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only
-
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMXs-3XMyc-EGFP-OMP25
Plasmid#83355PurposeFor tagging mitochondria with Myc epitopes (Control-MITO construct)DepositorInsert3XMyc-EGFP-OMP25
UseRetroviralExpressionMammalianAvailable SinceSept. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-hM3D(Gq)-mCherry
Plasmid#50460PurposeDouble floxed Gq-coupled hM3D DREADD fused with mCherry under the control of EF1a promoterDepositorInserthM3D(Gq)-mCherry (CHRM3 Human)
UseAAVTagsmCherryMutationSee supplemental documents for DREADD mutationsPromoterEF1aAvailable SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV[Expression]-mCherry:T2A:Hygro-EF1A>Luc2
Plasmid#174665PurposeExpresses humanized firefly luciferase and mCherry and Hygromycin resistance linked by T2A, each controlled by a strong promoterDepositorInsertsLUC2
mCherry:T2A:Hygro
UseLentiviral and LuciferaseTagsmCherry and hygromycin dual reporter gene linked …ExpressionMammalianPromoterHuman cytomegalovirus immediate early enhancer/pr…Available SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Fos-CreERT2
Plasmid#194643PurposeExpresses Cre-ERT2 under the control of c-Fos promoterDepositorInsertFos-CreERT2
UseAAVExpressionMammalianAvailable SinceJan. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAM007
Plasmid#170011PurposeEncodes PslyB-sfgfp reporter and TetR-controlled expression of S. Typhimurium PhoPDepositorArticleInsertsSuperfolder GFP
PhoP
UseSynthetic BiologyExpressionBacterialPromoterPLTetO-1 and PslyBAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-hM4D(Gi)-mCherry
Plasmid#50461PurposeDouble floxed Gi-coupled hM4D DREADD fused with mCherry under the control of EF1a promoterDepositorInserthM4D(Gi)-mCherry (CHRM4 Human)
UseAAVTagsHA and mCherryMutationSee supplemental documents for DREADD mutationsPromoterEF1aAvailable SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
5UAS zfSynaptophysin:GFP
Plasmid#74316PurposeA fusion of zebrafish synaptophysin to GFP under the control of 5UAS repeatsDepositorInsertsynaptophysin
TagsEGFPMutationQ12H and deletion of F13 (please see depositor co…Promoter5UASAvailable SinceMay 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hM3D(Gq)-mCherry
Plasmid#50476PurposeGq-coupled hM3D DREADD fused with mCherry under the control of CaMKIIa promoterDepositorHas ServiceAAV1, AAV2, AAV5, AAV8, and AAV9InserthM3D(Gq)-mCherry (CHRM3 Human)
UseAAVTagsmCherryMutationSee supplemental documents for DREADD mutationsPromoterCaMKIIaAvailable SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
At2S3:RUBY
Plasmid#160906PurposeRUBY under the control of At2S3 promoter/marker for Arabidopsis transgenesDepositorInsertRUBY and At2S3 promoter
ExpressionPlantPromoterAt2S3Available SinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBS598 EF1alpha-EGFPcre
Plasmid#11923PurposeExpresses EGFP-Cre fusion under the control of the EF1alpha promoter; EGFP is human codon-optimized.DepositorAvailable SinceMarch 23, 2007AvailabilityAcademic Institutions and Nonprofits only -
pJLG038
Plasmid#192981PurposeBHR plasmid (pBBR1 ori) expressing T7 polymerase under control of the lac promoterDepositorInsertT7 polymerase
ExpressionBacterialPromoterlacAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
YUC4:RUBY
Plasmid#160907PurposeRUBY under the control of YUC4 promoter/tissue specific marker for gene expressionDepositorInsertRUBY and YUC4 promoter
ExpressionPlantPromoterYUC4Available SinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hM4D(Gi)-mCherry
Plasmid#50477PurposeGi-coupled hM4D DREADD fused with mCherry under the control of CaMKIIa promoterDepositorHas ServiceAAV1, AAV2, AAV5, AAV8, and AAV9InserthM4D(Gi)-mCherry (CHRM4 Human)
UseAAVTagsmCherryMutationSee supplemental documents for DREADD mutationsPromoterCaMKIIaAvailable SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCWU6-xylR-E-lepB
Plasmid#190725Purposefine tune expression of type 1 signal peptidase under the control of xylose- and theophylline- inducible systemDepositorInsertxylR-E-lepB
ExpressionBacterialAvailable SinceOct. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBK-Ma pylRS nitroY/haloY-F5
Plasmid#212125PurposeExpresses Methanomethylophilus alvus pyrrolysine tRNA synthetase engineered for 3-nitroY and 3-haloY under GlnS promoter. Used as a control for Ma Pyl tRNA-synthetase selections.DepositorInsertM. alvus PylRS 3-NY/HaloY F5
ExpressionBacterialMutationCTG125CTT, N166A V168S, A223C, W239RPromoterGlnS (constitutive)Available SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-HA-hM4D(Gi)-IRES-mCitrine
Plasmid#50464PurposeGi-coupled hM4D-IRES-mCitrine under the control of human synapsin promoteDepositorAvailable SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
poRBS
Plasmid#154125PurposeExpresses orthogonal rRNAs operon in bacterial cellsDepositorInsertengineered bacterial rRNAs operon under control of pL promotor
UseSynthetic BiologyExpressionBacterialAvailable SinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJP_Ctrl10
Plasmid#219672PurposeContains PT3lacO promoter (regulated by blue light and LacI) controlling the expression of mCherry. LacI is constitutively produced by pR promoter.DepositorInsertsmCherry
lacI
PromoterPT3lacO and pRAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only