We narrowed to 10,454 results for: ESP
-
Plasmid#79534PurposeExpresses C-terminally EGFP-tagged Arf5(WT) in mammalian cellsDepositorAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pDN-G1TCbt
Plasmid#44515DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQCXIB Flag MFF WT
Plasmid#74384PurposeRetroviral expression vector containing Flag tagged WT MFF isoform 5DepositorAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1GZmbh
Plasmid#44516DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-ATXN1 FL(30Q)-S776D
Plasmid#21755DepositorInsertAtaxin-1 (ATXN1 Human)
TagsGSTExpressionMammalianMutationinsert contains a stretch of 32 amino acids (30 Q…PromoterCMVAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
GST-SF3B2 wild type aa 401-550 fragment
Plasmid#67615Purposebacterial expression of wild type GST-SF3B2 fragment (401-550)DepositorInsertsplicing factor 3b subunit 2 (SF3B2 Human)
TagsGSTExpressionBacterialMutationfragment of amino acids 401-550PromotertacAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA p21 K161Q, K163Q
Plasmid#78790PurposeTo overexpress p21 K161Q, K163Q in Mammalian CellsDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLINK cyclin T1 (1-280) myc (all 200) (P#575)
Plasmid#14610DepositorInsertcyclin T1 (1-280) (all 200) (CCNT1 Human)
TagsmycExpressionMammalianMutationC198A, C200A, H202A, C205A. Active in 3T3 cells.Available SinceJune 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAN19-3xFLAG-TIR1-NOSt
Plasmid#108545PurposeCloning vector including N-terminally 3xFLAG-tagged Arabidopsis auxin receptor TIR1 [Wild type] and NOS terminatorDepositorInsertTRANSPORT INHIBITOR RESPONSE 1 fused with 3xFLAG and NOS terminator (TIR1 Mustard Weed)
UseCloning vectorTags3xFLAGAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF2
Plasmid#106102PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF2DepositorInsertgRNA targeting CELF2 (CELF2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Flag MFF iso1 S172A
Plasmid#74391PurposeFlag tagged human S172A MFF isoform 1 mutantDepositorInsertFlag-MFF (MFF Human)
TagsFlagExpressionMammalianMutationdelta exon 1 (1-26) and Ser 172 Ala.Available SinceApril 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
GST-SF3B2 R508K aa 401-550 fragment
Plasmid#79674Purposebacterial expression of GST-SF3B2 fragment (401-550) with R508L methylation site mutationDepositorInsertsplicing factor 3b subunit 2 (SF3B2 Human)
TagsGSTExpressionBacterialMutationaa 451-550 with R508KPromotertacAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
psicheck-2-LPPRC
Plasmid#48167Purposecontains Renilla Luciferase gene preceded by an intact (ATG) upstream open reading frame elementDepositorInsertLRPPRC leucine rich pentatricopeptide repeat containing (Lrpprc Human)
UseLuciferaseAvailable SinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF1
Plasmid#106101PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF1DepositorInsertgRNA targeting CELF1 (CELF1 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAG182 FGFR1 3'UTR mut
Plasmid#12009DepositorInsertN15 3'UTR mut (FGFR1 Human)
UseLuciferaseExpressionMammalianMutationMutations in microRNA recognition sites (seed mat…Available SinceJune 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3XFLAG-MKK7-EE-NLS hygro
Plasmid#87780PurposeInducible expression of constitutively active mutant MKK7 with a C-terminal NLS sequenceDepositorAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only