We narrowed to 46,678 results for: cha;
-
Plasmid#107920PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_FL_P298L
Plasmid#104468Purposeexpress MBP-tagged full length hnRNPA2 P298LDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQRRA-P2A-GFP-PGK-Puro
Plasmid#110864PurposeLentiviral vector for constitutive expression of Cas9-VQRRA-P2A-GFP in mammalian cells (codon optimized)DepositorInsertCas9-VQRRA
UseLentiviralTagsFLAGMutationD1135V, R1335Q, T1337R and NLS sequence at the N-…PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-ALG13 (OTU, aa 216-353)
Plasmid#61414PurposeExpresses human ALG13 (OTU domain) in E. coli.DepositorInsertALG13 (Putative bifunctional UDP-N-acetylglucosamine transferase and deubiquitinase ALG13) (ALG13 Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-215 and aa 354-1137.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/HisMaxB-YAP2-1st&2nd WW mutant
Plasmid#19000DepositorInsertYes-kinase associated protein (YAP1 Human)
TagsHisExpressionMammalianMutationTryptophan 199 changed to Alanine, and Proline 2…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
FRT1-His-H2B-Cherry-2A (IG156)
Plasmid#99622PurposeTo clone gene of interest downstream of FRT1-His-H2B-Cherry-2A cassetteDepositorInsertHis-H2B-Cherry
ExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
4xnr UAS ifgMosaic Donor vector (IG230)
Plasmid#99631PurposeTo clone the 3 ORFs for Gal4 dependent generation of ifgMosaicsDepositorInsertN-PhiM
UseCre/LoxAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
FRT2-H2B-EGFP-V5-2A (IG157)
Plasmid#99623PurposeTo clone gene of interest downstream of FRT2-H2B-EGFP-V5-2A cassetteDepositorInsertH2B-EGFP-V5
TagsT2AExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAWp28-v1 scaffold
Plasmid#157976PurposepBT264-U6p-{2xBbsI}-v1 sgRNA scaffold-{MfeI} Note: This plasmid is unstable. Screen multiple colonies to identify full length clones.DepositorTypeEmpty backboneAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
LZF40: LZF40_Fsyn_Cre
Plasmid#109378PurposeSynaptic transmissionDepositorInsertCre-NCBI
UseLentiviralExpressionMammalianPromoterhuman synapsin IAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mkgDUX4mal*mqg*
Plasmid#21174DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianMutationFirst point mutation at nucleotide 5114 (numberin…Available SinceAug. 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRERRA-PGK-Puro
Plasmid#110859PurposeLentiviral vector for constitutive expression of Cas9-VRERRA in mammalian cells (codon optimized)DepositorInsertCas9-VRERRA
UseLentiviralTagsFLAGMutationD1135V, G1218R, R1335E, T1337R, and NLS sequence …PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL11
Plasmid#107917PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
FRT3-HA-H2B-Cerulean-2A (IG158))
Plasmid#99624PurposeTo clone gene of interest downstream of FRT3-HA-H2B-Cerulean-2A cassetteDepositorInsertHA-H2B-Cerulean
TagsT2AExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRERRA-P2A-Puro
Plasmid#110852PurposeLentiviral vector for constitutive expression of Cas9-VRERRA in mammalian cells (codon optimized)DepositorInsertCas9-VRERRA
UseLentiviralTagsFLAGMutationD1135V, G1218R, R1335E, T1337R, and NLS sequence …PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + M-AAT target
Plasmid#86008Purposelenti reporter plasmid with M-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
M-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-GP-α7-NACHO_EM
Plasmid#253979PurposeExpresses human alpha7 nicotinic acetylcholine receptor and nAChO in bicistronic systemDepositorInsertHuman alpha7 nicotinic acetylcholine receptor (CHRNA7 Human)
TagsTwin strep tagExpressionMammalianMutationDeletion in M3M4 loop with M3M4 loop insertion of…Available SinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-ATL2-WPRE-UbC-Emerald
Plasmid#225945PurposeLentiviral vector plasmid expressing human atlastin GTPase 2 (ATL2) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits only