We narrowed to 10,841 results for: esp
-
Plasmid#14610DepositorInsertcyclin T1 (1-280) (all 200) (CCNT1 Human)
TagsmycExpressionMammalianMutationC198A, C200A, H202A, C205A. Active in 3T3 cells.Available SinceJune 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAN19-3xFLAG-TIR1-NOSt
Plasmid#108545PurposeCloning vector including N-terminally 3xFLAG-tagged Arabidopsis auxin receptor TIR1 [Wild type] and NOS terminatorDepositorInsertTRANSPORT INHIBITOR RESPONSE 1 fused with 3xFLAG and NOS terminator (TIR1 Mustard Weed)
UseCloning vectorTags3xFLAGAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF2
Plasmid#106102PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF2DepositorInsertgRNA targeting CELF2 (CELF2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Flag MFF iso1 S172A
Plasmid#74391PurposeFlag tagged human S172A MFF isoform 1 mutantDepositorInsertFlag-MFF (MFF Human)
TagsFlagExpressionMammalianMutationdelta exon 1 (1-26) and Ser 172 Ala.Available SinceApril 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
GST-SF3B2 R508K aa 401-550 fragment
Plasmid#79674Purposebacterial expression of GST-SF3B2 fragment (401-550) with R508L methylation site mutationDepositorInsertsplicing factor 3b subunit 2 (SF3B2 Human)
TagsGSTExpressionBacterialMutationaa 451-550 with R508KPromotertacAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
psicheck-2-LPPRC
Plasmid#48167Purposecontains Renilla Luciferase gene preceded by an intact (ATG) upstream open reading frame elementDepositorInsertLRPPRC leucine rich pentatricopeptide repeat containing (Lrpprc Human)
UseLuciferaseAvailable SinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF1
Plasmid#106101PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF1DepositorInsertgRNA targeting CELF1 (CELF1 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAG182 FGFR1 3'UTR mut
Plasmid#12009DepositorInsertN15 3'UTR mut (FGFR1 Human)
UseLuciferaseExpressionMammalianMutationMutations in microRNA recognition sites (seed mat…Available SinceJune 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3XFLAG-MKK7-EE-NLS hygro
Plasmid#87780PurposeInducible expression of constitutively active mutant MKK7 with a C-terminal NLS sequenceDepositorAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Flag MFF iso4 S172A
Plasmid#74393PurposeFlag tagged human S172A MFF isoform 4 mutantDepositorInsertFlag-MFF (MFF Human)
TagsFlagExpressionMammalianMutationSer 172 Ala (numbering based on MFF isoform 1)Available SinceApril 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-ATXN1 FL(84Q)-S776A
Plasmid#21758DepositorInsertAtaxin-1 (ATXN1 Human)
TagsGSTExpressionMammalianMutationinsert contains a stretch of 84 Q(Glutamines) and…PromoterCMVAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-ATXN1 FL(30Q)-S776A
Plasmid#21756DepositorInsertAtaxin-1 (ATXN1 Human)
TagsGSTExpressionMammalianMutationinsert contains a stretch of 32 amino acids (30 Q…PromoterCMVAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPD1411 Simple SV40 HBS
Plasmid#253894PurposeIntegration Vector for LumiScarlet with the HBS(SV40_min) promoter (TUPV1), and AkaLuc-P2A-mTagBFP2-P2A-BlastR with the CAG promoter (TUPV2)DepositorInsertLumiScarlet, AkaLuc-P2A-mTagBFP-P2A-BlastR
UseSynthetic BiologyExpressionMammalianPromoterHBS(SV40_min), CAGAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1413 Simple YBTATAHBS
Plasmid#253896PurposeIntegration Vector for LumiScarlet with the HBS(YB_TATA) promoter (TUPV1), and AkaLuc-P2A-mTagBFP2-P2A-BlastR with the CAG promoter (TUPV2)DepositorInsertLumiScarlet, AkaLuc-P2A-mTagBFP-P2A-BlastR
UseSynthetic BiologyExpressionMammalianPromoterHBS(YB_TATA), CAGAvailable SinceApril 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDGB3omega2_[tNOS:BASTA:pNOS]-[EBSn:35Smp:GUS-(ggggs)x2-1x YPet:35Sterm]
Plasmid#254069PurposeGUS-YPet expression driven by EBSnDepositorInsertEBSn:35Smp:GUS-(ggggs)x2-1x YPet:35Sterm
UseSynthetic BiologyExpressionPlantAvailable SinceApril 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDGB3omega2_[EBSn:35Smp:3x SV40-NLS:3x YPet:35Sterm]-[tNOS:BASTA:pNOS]
Plasmid#254067Purpose3x YPet expression driven by EBSnDepositorInsertEBSn:35Smp:3x SV40-NLS:3x YPet:35Sterm
UseSynthetic BiologyExpressionPlantAvailable SinceApril 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDGB3omega2_[EBSn:35Smp:3x SV40-NLS:3x YPet:35Sterm]-[pNOS:KANAMYCIN:tNOS]
Plasmid#254071Purpose3x YPet expression driven by EBSnDepositorInsertEBSn:35Smp:3x SV40-NLS:3x YPet:35Sterm
UseSynthetic BiologyExpressionPlantAvailable SinceApril 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1291 CAG AkaLuc-P2A-mTagBFP2-P2A-BlastR in TU1
Plasmid#253918PurposeComponents for Integration Vectors: mMoClo TUPV, with CAG promoter and mTagBFP2-P2A-AkaLuc-2A-BlastR in the MCSDepositorInsertmTagBFP2-P2A-AkaLuc-2A-BlastR
UseSynthetic BiologyExpressionMammalianPromoterCAGAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only