We narrowed to 4,936 results for: AAT
-
Plasmid#136136PurposeL1 in position 3, to clone gRNA target using BbsI, lacZ blue-white screeningDepositorInsertp5-MpU6:lacZgRNA
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-SPN_ARR wt (Shank3)
Plasmid#175254PurposeSPN-ARR fragment in EGFP backbone for mammalian expressionDepositorInsertSPN-ARR fragment from SHANK3
ExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-TRPV1exCellHalo
Plasmid#220307PurposeMammalian expression vector for a subunit of rat TRPV1 with circularly permutated HaloTag inserted between the S5 and S6 transmembrane helicesDepositorInsertrTRPV1exCellHalo (Trpv1 Rat)
Tagscircularly permutated Halotag (Deo et al., Nat Ch…ExpressionMammalianMutationlinker included to insert cpHaloTag (PromoterCMV promoterAvailable SinceJuly 30, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBA-mCherry-EGFP-PIM
Plasmid#111758PurposeLow level expression of mCherry-EGFP-PIM. Can be used for inducible aggregate formation upon AP20187 additionDepositorInsert2x FKBP homo-mCherry-EGFP-2x FKBP homo-2x FKBP
ExpressionMammalianMutationVal24Glu, Tyr80Cys, Ala95Thr mutations in second …Promoterchicken beta-actinAvailable SinceOct. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRluc-LC3wt
Plasmid#105002PurposeMammalian expression of Rluc-LC3wt. Can be used for measuring autophagic flux.DepositorAvailable SinceJan. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
L1_lacZgRNA-Ck2
Plasmid#136137PurposeL1 in position 2, to clone gRNA target using BbsI, lacZ blue-white screeningDepositorInsertp5-MpU6:lacZgRNA
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-CDS
Plasmid#136039PurposeG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGCP123-GFP_g1
Plasmid#153518PurposesgRNA to GFP gene (NT) under nisin-inducible nisA promoter, barcodedDepositorInsertPnisA-sgRNA(GFP_g1)_dCas9 scaffold (barcoded)
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-sh-mSOX9-2
Plasmid#40645DepositorAvailable SinceOct. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLKO mouse shRNA 2 raptor
Plasmid#21340DepositorAvailable SinceJuly 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP TBRII
Plasmid#19147DepositorInsertTransforming growth factor, beta receptor II (TGFBR2 Human)
UseRetroviralTagsHAExpressionMammalianAvailable SinceOct. 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
GFP-PKI WT
Plasmid#118300PurposeExpression of PKIaDepositorInsertPKI wt
TagsFlag and GFPExpressionMammalianAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJ23119-sgRNA
Plasmid#113654PurposesgRNA targeting unit plasmid. The sgRNA targeting unit plasmids contain connector ConLS, ConR1, and one sgRNA transcriptional unit.DepositorInsertpromoter J23119 and sgRNA
UseCRISPRExpressionBacterialPromoterJ23119Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-3'UTR
Plasmid#136055PurposeCAPRIN1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCACGTTAGTGTCACAAATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_version2_U6_AtPDS3_gRNA10
Plasmid#197952PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter, with SV40 NLS at the C-terminal , and the AtPDS3 guide RNA 10 driven by U6 promoter.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterAtU6-26 and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRDA_834
Plasmid#216087PurposeCas9 [Sp] knockout targeting CD59, positive controlDepositorInsertCD59 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SFG.CNa12_opt.IRES.eGFP
Plasmid#22490DepositorAvailable SinceDec. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMXs_FLAG-SFXN3
Plasmid#110637PurposeRetroviral expression of Flag-SFXN3 in mammalian cellsDepositorAvailable SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only