We narrowed to 4,850 results for: U6...
-
Plasmid#192490PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVTagsExpressionMutationNoPromoter0.4CaMKIIaAvailable sinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-GFP-pA
Plasmid#192493PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVTagsExpressionMutationNoPromoterCMVAvailable sinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-MCS-pA
Plasmid#192496PurposeTo express CasRX gRNA and contains MCS to insert coding region of interestDepositorInsertCasRx
UseAAVTagsExpressionMutationNoPromoterCMVAvailable sinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-CasRx-pA
Plasmid#192485PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVTagsExpressionMutationNoPromoterCMVAvailable sinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-HA-TadA8e-Sauri-U6-Camk2d sgRNA7
Plasmid#220127PurposeExpresses SauriABE8e by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoter, and add an HA tag fused to TadADepositorInsertMYL2, TadA, nSauriCas9
UseAAVTagsHA tagExpressionMutationPromoterMYL2Available sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A6-gRNA_(CJT88)
Plasmid#226987PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A6)DepositorInsertSpCas9 gRNA A6 to create OPA1-R194G
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A7-gRNA_(CJT89)
Plasmid#226986PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A7)DepositorInsertSpCas9 gRNA A7 to create OPA1-R194G
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A9-gRNA_(CJT87)
Plasmid#226988PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A9)DepositorInsertSpCas9 gRNA A9 to create OPA1-R194G
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ03-pLenti-U1a-mSpCas9-U6-tracrRNA-PuroR
Plasmid#211815Purposelentiviral vector expressing SpCas9 and tracrRNA for stable cell line establishmentDepositorInsertSpCas9, tracrRNA and puromycin selection gene
UseLentiviralTagsExpressionMammalianMutationPromoterU1a promoter, U6 promoter, and hPGK promoterAvailable sinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-Agrp-(mouse)-MS2gRNA-hSyn-MCP-MSN
Plasmid#210709PurposeThis Plasmid express U6 promoter driven SpdCas9 specific gRNA and hSyn promoter driven MCP-MSN transactivation moduleDepositorInsertSpdCas9 specific Agrp (mouse) MS2gRNA and MCP-MSN
UseAAV and CRISPRTagsExpressionMammalianMutationN55K in MCPPromoterU6Available sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pegRNA entry vector - pUC19-U6-[BsmBI_entry]-term (MNW320)
Plasmid#208977PurposeEntry vector for human U6 promoter driven SpCas9-based pegRNAs, comprised of hU6-[BsmBI]-terminator (spacer and RTT/PBS oligos must be cloned in)DepositorInsertpUC19-U6-[BsmBI]-term (pegRNA_entry_vector)
UseCRISPRTagsBPNLSExpressionMammalianMutationPromoterhuman U6Available sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVTagsExpressionMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-AAVS1-MAFB-sgRNA
Plasmid#194725Purposebased on (CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector, Addgene 159281), with guide RNA array targeting both AAVS1 and MAFBDepositorArticleUseCRISPRTagsExpressionMammalianMutationD908APromoterAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)_g1_CASH-1
Plasmid#188975PurposeA human codon-optimized SpCas9 nickase and chimeric g1 guide RNA expression plasmid.DepositorInsertg1 guide RNA
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)_g2_CASH-1
Plasmid#188976PurposeA human codon-optimized SpCas9 nickase and chimeric g2 guide RNA expression plasmid.DepositorInsertg2 guide RNA
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 U6-26-1gRNA-DFR 2.1 (GB1838)
Plasmid#160625PurposeGB-cassette for the expression of a guide RNA targeting the DFR promoter with 2.1 Ms2 aptamer in the 3' of the scaffoldDepositorInsertU6-26-1gRNA-DFR 2.1
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterU6-26Available sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-3_PolyU(1)_Tornado-Corn
Plasmid#159503PurposeTests for the impact of 1 uracil in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-3_PolyU(1)
UseTagsExpressionMammalianMutationPromoterU6-27Available sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-2_PolyU(7)_Tornado-Corn
Plasmid#159493PurposeTests for the impact of 7 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-2_PolyU(7)
UseTagsExpressionMammalianMutationPromoterU6-27Available sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-2_PolyU(4)_Tornado-Corn
Plasmid#159490PurposeTests for the impact of 4 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-2_PolyU(4)
UseTagsExpressionMammalianMutationPromoterU6-27Available sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-2_PolyU(2)_Tornado-Corn
Plasmid#159488PurposeTests for the impact of 2 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-2_PolyU(2)
UseTagsExpressionMammalianMutationPromoterU6-27Available sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only