We narrowed to 16,337 results for: LEA
-
Plasmid#62805Purposeexpresses an inducible E2F2 mutant that lacks the Rb binding domainDepositorInsertE2F2 (E2F2 Human)
UseRetroviralTagsHA-ErExpressionMammalianMutationdeletion of amino acids 302-437, including the Rb…Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-Hook2
Plasmid#198524PurposeExpression of GAL4 DNA-binding domain (BD)-Hook2 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertHook2 (HOOK2 Human)
TagsGAL4-DNA binding domain fragmentExpressionYeastMutationHis488Gln substitutionPromoterADH1Available SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
HOXC4 (human) MSCV
Plasmid#8546DepositorInsertHOXC4 (HOXC4 Human)
UseRetroviralExpressionMammalianMutationContains improved ribosomal binding site and NcoI…Available SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-4S Tetherin
Plasmid#41073DepositorInsertTetherin (BST2 Human)
TagsFLAGExpressionMammalianMutationS74, S84, 137S, and 144SPromoterCMVAvailable SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
p2Flag CMV2-ZO-2-N
Plasmid#27418DepositorInsertZonula Occludens 2 (TJP2 Human)
Tags2xFlagExpressionMammalianMutationDeletion of the carboxy-terminus of ZO-2, so only…Available SinceApril 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
pClneoMyc MOB1 T12A
Plasmid#47936Purposeexpresses Myc tagged human MOB1 containing T12A mutationDepositorAvailable SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA(MS2)_zeo_hPDX1_promoter_guide1
Plasmid#176838PurposeTo induce human PDX1 expression by recruiting SAM complex to PDX1 promoterDepositorInsertsgPDX1
ExpressionMammalianPromoterU6Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-137.144S Tetherin
Plasmid#41072DepositorAvailable SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSN69
Plasmid#100125Purposeexpresses putative cMYC DBD with a HA tagDepositorInsertmCerulean-P2A-putative cMYC DBD with a HA tag (MYC Human)
UseLentiviralExpressionMammalianMutationInsert corresponds to the DBD of cMYCAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1a-EGFP-TA Bik-IRES-Puromycin
Plasmid#133026PurposeExpresses EGFP-tagged tail anchor sequence of BikDepositorInsertBcl-2-interacting killer (BIK Human)
UseLentiviralTagsEGFPExpressionMammalianMutationdeleted amino acids 1-110PromoterHuman elongation factor 1 alphaAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 D444-500
Plasmid#19839DepositorInsertMKL1 D444-500 (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationdeleted amino acids 444-500Available SinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
HOXB3 (human) HIS-tag pET
Plasmid#8524DepositorInsertHOXB3 (HOXB3 Human)
TagsHis and T7ExpressionBacterialMutationContains 5 additional amino acids before ATG from…Available SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-CUL1 L756A/I757A
Plasmid#19938DepositorInsertcullin 1 L756A/I757A (CUL1 Human)
TagsHA2ExpressionMammalianMutationMutation of two adjacent hydrophobic residues, L…Available SinceApril 17, 2009AvailabilityAcademic Institutions and Nonprofits only -
MAP1LC3A-V1
Plasmid#98569PurposeExpresses MAP1LC3A-V1DepositorAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWay21-MKP-1L16A/L17A
Plasmid#13478DepositorInsertMKP-1L16A/L17A (Dusp1 Mouse)
TagsEGFPExpressionMammalianMutationChanged Leucine 16 to Alanine; changed Leucine 1…Available SinceDec. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shEsco2
Plasmid#160957PurposeEsco2 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 T450A
Plasmid#19843DepositorInsertMKL1 T450A (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationchanged Threonine 450 to AlanineAvailable SinceDec. 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shBub1
Plasmid#160948PurposeBub1 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only