We narrowed to 6,928 results for: tac
-
Plasmid#101417PurposeDonor Vector containing GATA4 transcription factor, part of the Human TFome CollectionDepositorInsertGATA4 (GATA4 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA4(15))-PGKpuro2ABFP-W
Plasmid#200462PurposeLentiviral vector expressing gRNA targeting human SMARCA4DepositorInsertSMARCA4(15) (SMARCA4 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Arpc5 KI
Plasmid#131503PurposeEndogenous tagging of Arp2/3 complex subunit 5: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-2
Plasmid#118020PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
ATM gRNA (BRDN0001149033)
Plasmid#77531Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATM gRNA (BRDN0001146099)
Plasmid#77530Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000338462
Plasmid#78158PurposeshXPO1 targeting CDSDepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK1 gRNA (BRDN0001147355)
Plasmid#77787Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-3
Plasmid#223224Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-shRFP
Plasmid#125778Purposeconstitutive expression of a short-hairpin RNA targeting RFPDepositorInsertshRFP
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
AKT3 gRNA (BRDN0001146868)
Plasmid#76217Purpose3rd generation lentiviral gRNA plasmid targeting human AKT3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HK2 gRNA (BRDN0001162212)
Plasmid#76310Purpose3rd generation lentiviral gRNA plasmid targeting human HK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000338399
Plasmid#78156PurposeshXPO1 targeting CDSDepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-pGK-nAChRb2(E61C)-IRES-GFP
Plasmid#164777Purposecysteine mutated nAChR beta2 subunit (E61C) for the attachment of a photoswitchable tethered ligandDepositorInsertnAChR b2 E61C - IRES- GFP (Chrnb2 Mouse)
UseLentiviralExpressionMammalianMutationE61CPromoterpGKAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458-CCND1
Plasmid#172630PurposeExpresses a gRNA against CCND1 and Cas9 from S. pyogenes with 2A-EGFPDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
MAPK1 gRNA (BRDN0001147498)
Plasmid#77789Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-EGFP-GPI-stop-L2
Plasmid#186355PurposeEntry clone with ORF encoding plasma membrane-targeted EGFP-GPI fusion protein flanked by Gateway recombination sequencesDepositorInsertsignal peptide of human CD59, eGFP, aa 67-102 of human CD59 which contains the GPI attachment site (CD59 Human, Synthetic)
UseExpression of a fluorescent membrane markerTagsEGFPAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
DDR1 gRNA (BRDN0001162509)
Plasmid#78012Purpose3rd generation lentiviral gRNA plasmid targeting human DDR1DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only