We narrowed to 7,755 results for: Tet-on
-
Plasmid#183617PurposeMammalian expression vector: CAG promoter driving expression of nuclear envelope-tethered EGFP (NLS-EGFP-EmerinTMD). Confers puromycin resistance.DepositorInsertEGFP
TagsHuman EMD transmembrane domain and NLSExpressionMammalianPromoterCAGAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRJPaph-HcRed
Plasmid#67035PurposePlasmid for Paph-HcRed integration downstream of B. diazoefficiens (B. japonicum) scoIDepositorInsertsB. diazoefficiens DNA from scoI downstream region (comprising blr1132')
HcRed
UseConjugative bacterial vectorAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFE-vcDAB
Plasmid#133004PurposepFE carrying the vcdabA2 ( locus_tag: CSW01_RS07960) and vcdabB2 genes (locus_tag: CSW01_RS07955)DepositorInsertsvcdabB
vcdabA
ExpressionBacterialPromotertetRAvailable SinceNov. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
gRD21A-mRFP
Plasmid#181959PurposeRD21A protein tagged with mRFP, under control of native promoterDepositorInsertRD21A genomic sequence including 2kb upstream of the ATG
TagsmRFPExpressionPlantPromoterRD21A nativeAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorT(sp)
Plasmid#111255PurposeBroad host-range bacterial expression vector with constitutive Pc promoter followed by the E. coli TorT signal peptideDepositorInsertTorT signal peptide
ExpressionBacterialPromoterPcAvailable SinceJuly 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJK2067
Plasmid#171845PurposeC. elegans mex-5 promoter (germline) driven dual fluorescent reporter for boxB tethering (eGFP) with boxB negative control (mCherry)DepositorInserthis-58, eGFP, mCherry
TagsN-terminal Tag OLLAS, V5 and C-terminal Tag PEST…ExpressionWormMutationboxB wild type and hairpin mutantPromotermex-5 promoterAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCD5-ss-D/bovine/France/5920/2014-HEFwtED-GCN4-sfGFP-ST
Plasmid#175017PurposeExpresses influenza D virus trimeric hemagglutinin esterase fusion protein fused to a sfGFPDepositorInsertOK-HEFwtED
TagsGCN4-TEV-sfGFP-TwinStrepExpressionMammalianPromoterCMVAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-SwiChR-eYFP
Plasmid#166604PurposeEncodes Cre-dependent SwiChR-eYFP under control of the TREDepositorInsertSwiChR-eYFP
UseAAVPromotertetracycline response elementAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTPTP alpha (S204A)
Plasmid#17694DepositorAvailable SinceApril 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
p5A1-Ti
Plasmid#92018PurposeExpresses TALE targeted to lac operator with 3 TEV cut sites in its repeat domain, anhydrotetracycline inducible catalytically inactive TEV proteaseDepositorInsertsTALE targeting lac operator with 3 TEV cleavage sites
Catalytically Inactive TEV Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219V, C151AAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS1[LacI-L]
Plasmid#60745PurposeContains PI driving expression dimeric LacI, the Lactose inducible repressor.DepositorInsertLacI
UseSynthetic BiologyExpressionBacterialMutationwt LacI without the tetramerization domainAvailable SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
p5A7-T
Plasmid#92020PurposeExpresses TALE targeted to lac operator with one TEV cut site in its N-terminal domain and a second in the C-terminal domain, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lac operator with N and C-terminal TEV protease cleavage sites
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219VAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
p5A3-T
Plasmid#92019PurposeExpresses TALE targeted to lac operator with one TEV cut site in its N-terminal domain, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lac operator with N-terminal TEV cleavage site
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219VAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHL600
Plasmid#37563DepositorUseSynthetic BiologyExpressionBacterialPromoterpLlacO-1 and pLtetO-1Available SinceAug. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRS479
Plasmid#250493PurposeRegulatable CRISPRi plasmid for use in Candida albicans. Contains dCas9-Mxi1 controlled by a tetO promoter, NEUT5L integration site and the sgRNA cloning siteDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBABE-tTA-SV40-puro-T2A-TagBFP
Plasmid#254076PurposeRetroviral transfer vector for tTA expression, puromycin selection marker.DepositorInserttTA
UseRetroviralAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134B-TLS
Plasmid#245879PurposeGolden gate entry vector carrying TLS mobile RNA sequenceDepositorInsertTLS2
UseCRISPR and Synthetic BiologyExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B-PtALSgRNA
Plasmid#245880PurposeGolden gate entry vector carrying the gRNA for base editing in Poplar hybrid ALS geneDepositorInsertPtALSgRNA
UseCRISPRExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133B-TLS
Plasmid#245882PurposeGolden gate entry vector carrying TLS mobile RNA sequenceDepositorInsertTLS2
UseCRISPR and Synthetic BiologyExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only