We narrowed to 8,611 results for: gal
-
Plasmid#194190PurposeIncludes the promoter (1kb) of SMTS with 5 mutated KLF binding sites (positions 449,548,732,899,884)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutation5 mutated KLF binding sites (positions 449,548,73…PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 899
Plasmid#194193PurposeIncludes the promoter (1kb) of SMTS with mutated KLF binding sites (position 899)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated KLF binding sites (position 899)PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
iMb-Control-Mosaic (IR98.10)
Plasmid#99748PurposeRosa26 gene targeting vector to induce a Cre-dependent mosaic of cells expressing different fluorescent and marker proteins localized to the membraneDepositorInsertMbYFP, MbTomato, MbKate2
UseCre/Lox and Mouse TargetingExpressionMammalianAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Tre-Tight ifgMosaic Donor vector (LH121)
Plasmid#99630PurposeTo clone the 3 ORFs for Tet system (rtTA + Dox) dependent generation of ifgMosaicsDepositorInsertN-PhiM
UseCre/LoxMutation(Please see depositor comments below)Available SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBridge-tyrosinase.σ1A
Plasmid#197381PurposeExpression of 1) GAL4 DNA-binding domain (BD)-tyrosinase cytosolic tail fusion protein, 2) HA epitope and nuclear localization signal (NLS) AP-1 σ1A fusion protein in yeast (yeast three-hybrid assays)DepositorInsertstyrosinase cytosolic tail
AP-1 σ1A
TagsGAL4-DNA binding domain fragment, HA tag, and SV4…ExpressionYeastMutationContains an extra 42 nucleotides encoding 14 resi…PromoterADH1 and MET25Available SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgMARK3
Plasmid#138690PurposeExpresses a human MARK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pChuk
Plasmid#87033Purposeexpress IKKalpha in mammalian cellsDepositorAvailable SinceJuly 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTT5-hSDC1-CS1
Plasmid#52365Purposeexpresses human Syndecan-1 point mutant at S184A in HEK293-EBNA1 (293E) suspension culture.DepositorInsertSDC1 (SDC1 Human)
ExpressionMammalianMutationR95Q and S184A (according to numbering in Fig. 2A…PromoterCMVAvailable SinceDec. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pQC MCS IRES G418
Plasmid#110344Purposeγ-Retroviral transfer vector for cloning and expressing your gene of interest. IRES-driven Geneticin selection.DepositorTypeEmpty backboneUseRetroviralExpressionMammalianPromoterCMVAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-EVA1ext-hFcIgG3-IRES-YFP
Plasmid#64926PurposeTo express extracellular portion of EVA1 (mouse) fused with human Fc(IgG3)DepositorUseRetroviralTagsIRES-YFPExpressionMammalianPromoterLTRAvailable SinceJune 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000297275
Plasmid#78152PurposeshCDK4 targeting 3UTRDepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
MEK1C218
Plasmid#164639PurposeBacterial expression plasmid for His6-MEK1C218DepositorInsertmitogen-activated protein kinase kinase 1 (MAP2K1 Human)
TagsHis6-tagExpressionBacterialMutationG(-19)F/S218C/C277S/C376SPromoterT7Available SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTT5-hSDC1-S15A
Plasmid#52363Purposeexpresses human Syndecan-1 serine 15 mutated to alanine (numbering excludes signal peptide) in HEK293-EBNA1 (293E) suspension culture.DepositorInsertSDC1 (SDC1 Human)
ExpressionMammalianMutationS15A and R95Q (according to numbering in Fig. 2A …PromoterCMVAvailable SinceDec. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000279952
Plasmid#78155PurposeshCDK4 targeting 3UTRDepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000279887
Plasmid#78153PurposeshCDK4 targeting CDSDepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000279953
Plasmid#78154PurposeshCDK4 targeting CDSDepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUAST-HA, Pbl-A PH+DH domains
Plasmid#69793PurposePebble isoform A, PH and DH domains, in P element-based pUAST vector for Gal4-regulated expression in Drosophila.DepositorInsertPebble DH +PH domains (pbl Fly)
UseP element-based puast vector for gal4-regulated e…TagsHA tagExpressionInsectMutationPbl-A (NP_729306.1) amino acids 385-647.Promoterhsp70 promoterAvailable SinceNov. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-HaloTag-P2A-RSV M2-1-C-terminal-1xSunTag
Plasmid#246867PurposeExpress HaloTag-P2A-RSV M2-1-C-terminal-1xSunTag (M2-1exo-SunTag) for RSV imaging.DepositorInsertHaloTag-P2A-RSV M2-1-C-terminal-1xSunTag
UseLentiviralTagsHaloTagExpressionMammalianMutationThe RSV M2-1 protein with a C-terminal insertion …PromoterSFFVAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3-FGF6-V5
Plasmid#124090PurposeFGF6-V5 tagged expression vectorDepositorInsertFGF6 (FGF6 Human)
UseLentiviralTagsV5Mutation3 silent SNPs: (189) C>G, (366) T>C and (41…Available SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only