We narrowed to 11,213 results for: AGA
-
Plasmid#59614PurposeExpression of shRNA against human ATF7IPDepositorAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pHR_PGK 3XFlag_4D5-5_CAR-mCherry
Plasmid#247508PurposeExpresses a CAR against HER2 and mCherryDepositorInsertCAR against Her2 and mCherry
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-HA-hRb-delta-CDK-puro
Plasmid#212673PurposeExpress tagged hRb delta-CDK phosphosite mutantDepositorInsertRb (RB1 Human)
UseLentiviralTagsHAMutationAll 15 CDK phospho-sites are mutated to alaninesPromoterTREAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBS CMV NA 3C FLAG SA
Plasmid#234993PurposeExpression of transmembrane region of Neuraminidase protein fused to streptavidin protein for displaying on viral like particles (VLPs) when cotranfected with GAG proteinDepositorInsertNA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNA 3C myc scfvHA
Plasmid#234991PurposeExpression of transmembrane region of Neuraminidase protein fused to an anti HA scFv antibody fragment for displaying on Viral like particles (VLPs) when cotranfected with GAG proteinsDepositorInsertNA-3C-myc-scfvHA
ExpressionMammalianAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVUTHshGATA1-tTR-KRAB
Plasmid#11650PurposeTet-regulated (Tet-on) lentiviral vector for shGATA1 (hUbiquitin promoter) - 3rd generationDepositorInserthUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on (GATA1 Human)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSIL-eGFP-shACTN1
Plasmid#52676PurposeshRNA against α-actinin-1 with eGFP transfection markerDepositorAvailable SinceJune 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCW-HA-hRb-WT-T373A-S608A-S612A-puro
Plasmid#212674PurposeExpress tagged hRb mutantDepositorAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_Lb
Plasmid#155051PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSIL-eGFP-shACTN4
Plasmid#52679PurposeshRNA against α-actinin-4 with eGFP transfection markerDepositorAvailable SinceJune 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCIneoLuc-PP2A
Plasmid#128349PurposeVector for LUMIER assayDepositorAvailable SinceSept. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-H2B-HaloTag-FRT
Plasmid#247338PurposeExpresses H2B-Halo under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-35kb-DSF-1-6
Plasmid#227487Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-29kb-USF
Plasmid#227466Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 29kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-2.4kb-USF
Plasmid#227477Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 2.4kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-3.3kb-USP
Plasmid#227450Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 3.3kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-55kb-USF
Plasmid#227458Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 55kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only