We narrowed to 25,251 results for: promoter
-
Plasmid#92394PurposeChick-specific U6 sgRNA expression mini-vector, harbouring chick U6_3 pol III promoter, with tracrRNA scaffold containing stem loops allowing binding of bacteriophage MS2 coat protein MCPDepositorInsertchick U6.3 promoter and gRNA cloning cassette including MS2 stem loops
UseCRISPRExpressionMammalianPromoterchick U6.3Available SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 2xFLAG-2xSTREP-Keap1 (mouse)
Plasmid#236421Purposetransient overexpression of KEAP1 in mammalian cellsDepositorInsertKEAP1 (Keap1 Mouse)
ExpressionMammalianAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJEP11-AAV-U6/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82705PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
plenti-CAG-IKZF3-FLAG-IRES-GFP
Plasmid#107388PurposeLentiviral expression of IKZF3-FLAGDepositorAvailable SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
T/Brachyury-eGFP Rex Neo
Plasmid#21222DepositorInsertBrachyury promoter
UseLentiviralTagseGFPAvailable SinceJuly 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLX317-VRK1
Plasmid#199643PurposeExpresses VRK1DepositorInsertVRK1 (VRK1 Human)
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn LAMP1-msGFP (JV012)
Plasmid#179728PurposeLentiviral expression of LAMP1-msGFP for use as a lysosomal markerDepositorInsertLAMP1 (Lamp1 Mouse)
UseLentiviralAvailable SinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Polymerase expression - pCMV-T7-EcKlenow (LM2692)
Plasmid#208963PurposeUnfused EcKlenow DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorInsertEcKlenow-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationEcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNCST-AausGFP
Plasmid#129503PurposeExpresses AausGFP constitutively in E. coli (most strains)DepositorInsertAausGFP
ExpressionBacterialPromotersynthetic constitutive (stationary phase) promote…Available SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDH-SIRT2-Flag
Plasmid#102624PurposeExpresses full length SIRT2 isoform 1 in mammalian cellsDepositorAvailable SinceJan. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-VRQR-P2A-EGFP (RTW3161)
Plasmid#139992PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-VRQR(D1135V/G1218R/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-VRQR with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationVRQR=D1135V/G1218R/R1335Q/T1337RPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-RFP-IKZF1-sh3
Plasmid#69042PurposeLentiviral expression of IKZF1 shRNADepositorAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 FLAG FBXO31
Plasmid#236429Purposetransient overexpression of FBXO31 in mammalian cellsDepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2K7-bsd-UBI-tagRFP-KDEL
Plasmid#114179PurposeLentiviral vector for expression of tagRFP with a signal peptide and KDEL ER retention signal for expression of tagRFP in the ERDepositorInserttagRFP-KDEL
UseLentiviralTagsKDEL retention signal and signal peptideExpressionMammalianPromoterUbiquitinAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
7TFP CDH1 mutant reporter
Plasmid#91703Purposelentiviral luciferase reporter containing CDH1 promoter with mutant E-boxesDepositorInsertCDH1 mutant promoter (CDH1 Human)
UseLentiviral and LuciferaseTagsluciferaseExpressionMammalianMutationmutant E-boxesPromoterCDH1 mutantAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgTrack-BFP
Plasmid#164273PurposeEmpty sgRNA expression vector with co-expression of BFP reporterDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EFSAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR1a-tagRFP-KDEL
Plasmid#114177PurposeGateway entry clone containing tagRFP with a signal peptide and KDEL ER retention signal for expression of tagRFP in the ERDepositorInserttagRFP-KDEL
UseGateway entry cloneTagsKDEL retention signal and signal peptideAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
scaffold-linker-U6
Plasmid#89639Purposeconstruction of paired sgRNAs driven by two U6 promoters. Vector itself only has one U6 promoter.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterhU6Available SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-hBMPR-1A CA
Plasmid#49527Purposeexpresses constitutively active human BMP receptor 1ADepositorInsertBMPR-1A CA (BMPR1A Human)
ExpressionMammalianMutationconstitutively active mutation (Q233D); also P2A …PromoterCMVAvailable SinceMay 20, 2014AvailabilityAcademic Institutions and Nonprofits only