We narrowed to 11,495 results for: aga
-
Plasmid#227450Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 3.3kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-55kb-USF
Plasmid#227458Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 55kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSuper DGK alfa human
Plasmid#224574PurposeTo downregulate the expression of human DGK alfa in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper DGK alfa mouse
Plasmid#224573PurposeNegative Control for expression downregulation of DGK alfa human in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-DDX17-ts1
Plasmid#174238PurposeDDX17 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-hcr5
Plasmid#193661PurposeExpression of tandem pre-sgRNA array hcr5 for LbCas12aDepositorInsertU6-DNMT3B-sgRNA-KLF4-sgRNA-TET1-sgRNA-PRR5L-sgRNA-CFTR-sgRNA-tRNA
ExpressionMammalianPromoterU6Available SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-miniDi-P2A-mCherry
Plasmid#204358PurposeAAV vector for miniDi expression under the control of human synapsin promoterDepositorInsertminiDi-P2A-mCherry
UseAAVTagsmCherryMutationThe third intracellular loop (ICL3) of hM4Di was …PromoterhSynAvailable SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-miniDq-P2A-mCherry
Plasmid#204357PurposeAAV vector for miniDq expression under the control of human synapsin promoterDepositorInsertminiDq-P2A-mCherry
UseAAVTagsmCherryMutationThe third intracellular loop (ICL3) of hM3Dq was …PromoterhSynAvailable SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCold-I-Dsup
Plasmid#90021PurposeTo express His-tagged Dsup in bacteriaDepositorInsertDsup
TagsHisExpressionBacterialPromotercspAAvailable SinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mouse cGAS #2-gRNA-Cas9-Puro
Plasmid#186891PurposegRNA targeting mouse cGAS (with Cas9 insert)DepositorInsertCas9 (Cgas Mouse)
UseLentiviralAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNA 3C myc scfvFLAG
Plasmid#234990PurposeExpression of transmembrane region of Neuraminidase protein fused to an anti FLAG scFv antibody fragment for displaying on Viral like particles (VLPs) when cotranfected with GAG proteinDepositorInsertNA-3C-myc-scfvFLAG
ExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-HA-hRb-delta-CDK-puro
Plasmid#212673PurposeExpress tagged hRb delta-CDK phosphosite mutantDepositorInsertRb (RB1 Human)
UseLentiviralTagsHAMutationAll 15 CDK phospho-sites are mutated to alaninesPromoterTREAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pStreptagII 3C SMO
Plasmid#234995PurposeExpression of a Strep-tag II labeled on its N-terminus receptor, with the Smoothened (Smo) receptorDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEABR NA 3C FLAG SA
Plasmid#234987PurposeFor production of Extracellular Vesicles (EVs), with the transmembrane region of Neuraminidase protein fused to Streptavidin on the vesicles surfaceDepositorInsertEABR-NA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…Available SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-HA-hRb-delta-CDK-T373D-S608D-S612D-puro
Plasmid#212675PurposeExpress tagged hRb phosphosite mutantDepositorInsertRb (RB1 Human)
UseLentiviralTagsHAMutation15 CDK phospho-sites are mutated to alanines, and…PromoterTREAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX335-NQL002-WAPL-sgRNA1
Plasmid#175550PurposeFor transient expression of spCas9-nickase and one sgRNA targeting the mouse WAPL locus. Use together with pX335-NQL003-WAPL-sgRNA2 targeting construct.DepositorInsertspCas9-nickase and sgRNA against mouse WAPL STOP Codon
UseMouse TargetingExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only