We narrowed to 19,262 results for: Tat
-
Plasmid#130962PurposeEngineered sgRNA-LEB5 generator including Anderson promoter J23100 for golden gate assemblyDepositorInsertsgRNA-LEB5
UseSynthetic BiologyExpressionBacterialPromoterAnderson promoter J23100Available SinceSept. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/GFP4_Seq1.3
Plasmid#206136PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1 (Col1a1 Mouse)
ExpressionMammalianAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_3
Plasmid#155071PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
tet pLKO.1-shCSE1L v2 puro
Plasmid#192346PurposeLentiviral expression vector for an inducible shCSE1L v2)DepositorInsertshCSE1L v2 (CSE1L Human)
UseLentiviralAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGI3EM11
Plasmid#135483PurposeAgrobacterium T-DNA with SpunH2Bpr driving hph-GFPDepositorInsertSpunH2Bpr hph-GFP ADH1t
TagsGFPExpressionBacterial and YeastPromoterSpunH2BprAvailable SinceMay 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_4
Plasmid#155062PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGI3EM31
Plasmid#135491PurposeAgrobacterium T-DNA with Spun H2Bpr driving hph-mCerulean3DepositorInserthph SpunH2A/Bpr hph-mCerulean3
TagsmCerulean3ExpressionBacterial and YeastPromoterSpunH2A/Bpr (divergent)Available SinceMay 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUDR295
Plasmid#113874Purposeexpression of Cas9 programming sgRNA2 and sgRNA1 targetting GAL2 and HXT4-1-5/ HXT3-6-7 respectivelyDepositorInsertsgRNA2 GAL2 sgRNA1-HXT4-1-5;HXT3-6-7
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgRBFOX1-2098
Plasmid#115452PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
MAP3K3 gRNA (BRDN0001148097)
Plasmid#76016Purpose3rd generation lentiviral gRNA plasmid targeting human MAP3K3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 899
Plasmid#194193PurposeIncludes the promoter (1kb) of SMTS with mutated KLF binding sites (position 899)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated KLF binding sites (position 899)PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 449,548,732,899,884 (All)
Plasmid#194190PurposeIncludes the promoter (1kb) of SMTS with 5 mutated KLF binding sites (positions 449,548,732,899,884)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutation5 mutated KLF binding sites (positions 449,548,73…PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
TrpLE-M-nMSP1E3D1
Plasmid#179949PurposeTagless membrane scaffold protein (MSP) for formation of nanodiscs.DepositorInsertTrpLE-M-nMSP1E3D1
TagsTrpLEExpressionBacterialMutationNative Trp residues have been mutated to Phe resi…PromoterT7Available SinceFeb. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-CH115gp160-QES.c14-754*
Plasmid#123282PurposeMammalian expression plasmid for Env from the CH115 HIV-1 isolate; C-terminal truncation; QES mutant for enhanced presentation of quaternary epitopesDepositorInsertHIV-1 (CH115) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET22b-ecDHFR-N23PP/L28F/G51PEKN
Plasmid#118585PurposeBacterial expression of E.coli DHFR N23PP, L28F, and G51PEKN mutantDepositorInsertDHFR
ExpressionBacterialMutationN23 mutated to P23, L28 mutated to F28, G51 mutat…PromoterT7Available SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
TAF1 gRNA (BRDN0001147230)
Plasmid#77869Purpose3rd generation lentiviral gRNA plasmid targeting human TAF1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Arabidopsis thaliana Atm3 d80 pET21a+
Plasmid#173045PurposeExpresses AtAtm3 in E.coliDepositorInsertArabidopsis thaliana Atm3 (ABCB25 Mustard Weed)
Tags6xHis tagExpressionBacterialMutationwith N-terminal 80 amino acids deletionAvailable SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-DIO-AppNL-G-F-T2A-mCherry
Plasmid#242649PurposeFloxed (DIO) AAV transgene designed to be packaged in AAV and to express the amyloid precursor protein (App) with familial mutations AppNL-G-F in a Cre-recombinase-dependent manner.DepositorInsertFloxed (DOI) AAV transgene expressing an amyloid precursor protein with familial mutations and an mCherry tag
UseAAV, Cre/Lox, and Mouse TargetingExpressionMammalianMutationThe amyloid precursor reading frame contains a c…Promoterhuman synapsinAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_DED/AAA USP7
Plasmid#131253PurposeMammalian expression of an N-terminally Myc-tagged USP7 mutant, with mutations in UBL2 (DE758AA_D764A)DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianMutationContains point mutations that convert USP7 aspart…Available SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only