We narrowed to 17,934 results for: multi
-
Plasmid#99049PurposeTranscription Factor chassis for activation domains. mCherry, Zif268 DNA binding domain, estrogen response domainDepositorInsertsExpressionYeastAvailable sinceMarch 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
pC-SUR-YR
Plasmid#61768PurposeYeast recombinational cloning compatible Agrobacterium tumefaciens ternary vector containing sulfonylurea resistance gene (ILV alelle from Magnaporthe oyrzae) on transfer DNA (TDNA).DepositorInsertsSur gene
2 micron origin or replication and URA3 gene for S. cerevisiae
UseTernary vector for agrobacterium mediated transfo…PromoterMagnaporthe oryzae ILV promoterAvailable sinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDiCre-mCherry
Plasmid#164572PurposeIntegration of a DiCre cassette in PbGFP parasite genomeDepositorInsertsFKBP12-CRE59
FRB-CRE60
mCherry
Bifunctional dihydrofolate reductase-thymidylate synthase (TGME49_249180 Toxoplasma gondii)
UseCre/LoxPromoterBidirectional PbEF1alpha promoter (PBANKA_1133300…Available sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-Pan-Nav1 Na+ channel [N419/40R]
Plasmid#114552PurposeMammalian Expression Plasmid of anti-Pan-Nav1 Na+ channel (Human). Derived from hybridoma N419/40.DepositorInsertanti-Pan-Nav1 Na+ channel (Homo sapiens) recombinant mouse monoclonal antibody (SCN5A Mouse)
ExpressionMammalianPromoterdual CMVAvailable sinceJune 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
HisGB1-Hif1a(776-826) + CBP TAZ1(340-439)
Plasmid#99343PurposeBacterial expression of mouse CBP TAZ1 domain as coexpression with Hif1a TADDepositorAvailable sinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2-TGFBR2-m3_3'UTR
Plasmid#31883DepositorInsertTGFBR2 mutant 3'UTR (TGFBR2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationThird miR-302b, 372 7-mer seed match mutated from…PromoterSV40Available sinceSept. 14, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMX-Flag-WIP 460 deletion
Plasmid#11773DepositorInsertWIP aa1-460 (WIPF1 Human)
UseRetroviralTagsflagExpressionMammalianMutationaa461-503 deletedAvailable sinceFeb. 15, 2007AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Dynein-2_complex
Plasmid#132536PurposeFull length human (Hs) IFT dynein (dynein-2) complex for Sf9 expression. Contains His-ZZ-TEV-SNAPf-HC, WDR60, WDR34-Strep, LIC3, TCTEX-1, TCTEX1D2, LC8-1, LC8-2, TCTEX-3, Rbl-1, Rbl-2, LC8-like.DepositorInsertsTags8x His, Linker-TEV-linker-TEV, SNAPf, Strep, and …ExpressionInsectMutationCodon optimised for Sf9 expressionAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHX_HDR_hPAX7_IRES-EGFP-PGK-Neo
Plasmid#160458PurposeHomology-directed recombination donor vector for EGFP reporter knock-in to human PAX7 3' UTRDepositorUseInsertion of a fluorescent reporter through homol…Available sinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-Neo-UBC-M2rtTA-H2BmNeon (donorAB-UBC-mNeon)
Plasmid#85800PurposedonorAB-UBC-Neon targeting vector for human AAVS1 locus; knock-in of Dox controlled H2BneonDepositorInsertPPP1R12C (PPP1R12C Human)
UseHuman targetingMutationhomology arms for knock-in into first intronAvailable sinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasWT/sgKras/Cre
Plasmid#99848PurposeExpresses Cre-recombinase, a barcoded HDR template that serves as a control for HDR into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDN-T1GZmbh
Plasmid#44522DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationThree tandem tet operators (3XtetO2) downstream o…PromoterPGal1-T123 promoterAvailable sinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGem-nHyPer:sAPX
Plasmid#84735PurposeSimultaneous expresion of stromal HyPer2 and stromal Ascorbate peroxidase (APX) in plant cellsDepositorInsertsTagsnuclear localisation signals from the coding sequ…ExpressionPlantPromoterFMV/35SAvailable sinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRS1005
Plasmid#247641PurposeConstitutive CRISPRa-HyperdCas12a for Candida albicansDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable sinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSGH2
Plasmid#186706Purposean artificial heat-inducible promoterDepositorInsertsGFP
luc
Available sinceSept. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDM
Plasmid#110740PurposePlasmid for the insect cell expression system, two promoters, Multiplication Module M, Tn7 transpositionDepositorTypeEmpty backboneExpressionInsectAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ147
Plasmid#69299PurposeGolden Gate recipient and Gateway entry vector; assembly of 7 gRNAsDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTH726-CEN-RLuc/minCFLuc
Plasmid#38210DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pWS5321-CRISPRai-Markerless
Plasmid#182828PurposeSaccharomyces cerevisiae inducible CRISPRai vector - markerlessDepositorTypeEmpty backboneUseCRISPRAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only