We narrowed to 23,940 results for: promoter
-
Plasmid#90173PurposepEGFP-N1 with cDNA encoding HsKIF13B aa residues 1-557DepositorAvailable SinceMay 18, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pBabe-Puro-FLAG-Neuroserpin oloop
Plasmid#58262PurposeRetroviral vector for expressing mutated Neuroserpin in mammalian cellsDepositorInsertNeuroserpin (SERPINI1 Human)
UseRetroviralTagsFLAGExpressionMammalianMutationMutant of neuroserpin lacking five residues from …Available SinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
hKLF6 P148L (1009)
Plasmid#49497Purposeexpresses human KLF6 with P148L mutationDepositorAvailable SinceMay 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
flag-hKLF6 P149S (1008)
Plasmid#49496Purposeexpresses human Flag tagged KLF6 with P149S mutationDepositorAvailable SinceFeb. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
LP346
Plasmid#90175PurposepEGFP-C1 with cDNA encoding HsKIF13B aa residues 1-1000DepositorAvailable SinceJune 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMV-FFluc-GPD1L-3'UTR WT
Plasmid#32488DepositorAvailable SinceOct. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
2.3 hA33 luciferase
Plasmid#68148Purposeluciferase reporter for hA33 promoterDepositorInsertA33 (GPA33 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationstarts at -2270 relative to ATGPromoterhuman GPA33 promoterAvailable SinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
integrin alpha9 / alpha4 pcDNA1 neo
Plasmid#13587DepositorInsertintegrin alpha 9 / alpha 4 (ITGA9 Human)
ExpressionMammalianMutationIntegrin alpha 9 chimera containing the cytoplasm…Available SinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
integrin alpha9 / alpha2 pcDNA1 neo
Plasmid#13586DepositorInsertintegrin alpha 9 / alpha 2 (ITGA9 Human)
ExpressionMammalianMutationIntegrin alpha 9 chimera containing the cytoplasm…Available SinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.BRWD3-V5H
Plasmid#48624PurposeExpresses Drosophila BRWD3 (with V5 and His tags at the C-terminus) in mammalian cellsDepositorInsertBRWD3 (BRWD3 Fly)
TagsV5 and His tagsExpressionMammalianMutationno mutations, stop was removed to fuse V5His at C…PromoterCMVAvailable SinceOct. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
integrin alpha9 W999A pcDNA1 neo
Plasmid#13589DepositorAvailable SinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
CMV-FFluc-GPD1L-3'UTR Full mut
Plasmid#32489DepositorInsertGPD1L 3'UTR (Gpd1l Mouse)
TagsLuciferaseExpressionMammalianMutationMutated in the entire miR-210 binding regionPromoterCMVAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
CMV-FFluc-GPD1L-3'UTR Seed Mut
Plasmid#32490DepositorAvailable SinceNov. 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiX_(loxPconDIAL-YB_TATA)-mCherry-HRasG12V-BGH_pKG3906
Plasmid#246345PurposeloxPcon DIAL Reporter Lentivirus expressing mCherry-HRasG12V in the presence of ZFaDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
(203-bp-DIAL-YB_TATA)-Halo-p53-BGH_pKG2745
Plasmid#246339Purpose203-bp DIAL Reporter Plasmid with YB_TATA expressing Halo-p53 in the presence of ZFa and editable by Cre recombinaseDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL357
Plasmid#243711PurposeA piggyBac vector containing the COX7A2 coding sequences, modified with silent mutations to allow for PCR-based analysis, along with endogenous promoter and UTRs.DepositorAvailable SinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-c-fos-CytoTape-V5
Plasmid#239429PurposeCytoTape signal monomer for recording c-fos promoter transcriptional activityDepositorInsertCytoTape-V5
UseAAVTagsV5-dMBPExpressionMammalianPromoterc-fos promoterAvailable SinceOct. 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-Arc-CytoTape-V5
Plasmid#239424PurposeCytoTape signal monomer for recording SARE-ArcMin promoter transcriptional activityDepositorInsertCytoTape-V5
UseAAVTagsV5-dMBPExpressionMammalianPromoterSARE_ArcMin promoterAvailable SinceOct. 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
LLP965
Plasmid#239887PurposeWild type CaMV 35S promoter engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only