We narrowed to 7,866 results for: chloramphenicol
-
Plasmid#235115PurposeQuantitative bacterial two-hybrid (qB2H). Expresses Asf1B and IP1.DepositorInsertsUseSynthetic Biology; Quantitative bacterial two-hyb…TagscI_E34P-rpoAExpressionBacterialPromoterLtetO and lpp+lacUV5Available SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pCAGEN-DEST (JDW 471)
Plasmid#242573PurposeGateway destination vector with a CAGGS promoter in the backbone.DepositorTypeEmpty backboneUseGateway subcloningAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-HDAC1
Plasmid#109209PurposeEncodes human full-length HDAC1 to be expressed in a baculovirus/insect cell expression systemDepositorInserthuman full-length HDAC1, sequence-optimized for insect cells (HDAC1 Synthetic, Human)
ExpressionInsectPromoterPolyhedrinAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-AtmiR173aTS-B/c
Plasmid#227964PurposeEntry plasmid with AtmiR173aTS and a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertsB/c
AtmiR173aTS
PromoterNoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtmiR173aTS-B/c
Plasmid#227965PurposeExpression plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. For expressing syn-tasiRNAs in Arabidopsis thaliana.DepositorInsertsB/c
AtmiR173aTS
ExpressionPlantPromoter35S and NoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-NbmiR482aTS-B/c
Plasmid#227966PurposeEntry plasmid with NbmiR482aTS and a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertsB/c
NbmiR482aTS
PromoterNoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS∆P2
Plasmid#225197PurposeUsed to create a markerless deletion of the E. coli HS P2 phageDepositorInsertP2 phage homology arms
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS∆tum
Plasmid#225198PurposeUsed to create a markerless deletion of the E. coli HS tum geneDepositorInserttum homology arms
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS_gpN:SpyTag
Plasmid#225193PurposeUsed for adding C-terminal SpyTag to the E. coli HS P2 phage major capsid proteinDepositorInsertgpN homology arms and SpyTag
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSIP103: pTarget(CyCAST)
Plasmid#200849PurposeTarget plasmid containing CyPSP1 and attachement site for CyCAST.DepositorInsertsPAM for CyCAST + CyPSP1
tRNA-Leu
ExpressionBacterialAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pM-mKate2
Plasmid#228629PurposeMammalian expression of mKate2 and extra insert, for MuSIC barcode constructionDepositorInsertmKate2
ExpressionMammalianMutationWe introduced some silent mutations to avoid esse…PromoterCMVAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pM-LSSmOrange
Plasmid#228619PurposeMammalian expression of LSSmOrange and extra insert, for MuSIC barcode constructionDepositorInsertLSSmOrange
ExpressionMammalianMutationWe introduced some silent mutations to avoid esse…PromoterCMVAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
SBC015869
Plasmid#226281PurposeExpresses MsCAD from trc promoter; expresses BsSfp and SrCAR from a separate trc promoter. Biosynthesis of (hydroxy)cinnamyl alcohols from (hydroxy)cinnamic acids.DepositorInserts4'-phosphopantetheinyl transferase Sfp
Cinnamyl alcohol dehydrogenase
Carboxylic acid reductase
ExpressionBacterialAvailable SinceNov. 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pM-mBeRFP
Plasmid#228620PurposeMammalian expression of mBeRFP and extra insert, for MuSIC barcode constructionDepositorInsertmBeRFP
ExpressionMammalianMutationWe introduced some silent mutations to avoid esse…PromoterCMVAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM-mTFP1
Plasmid#228621PurposeMammalian expression of mTFP1 and extra insert, for MuSIC barcode constructionDepositorInsertmTFP1
ExpressionMammalianMutationWe introduced some silent mutations to avoid esse…PromoterCMVAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM-CyOFP1
Plasmid#228623PurposeMammalian expression of CyOFP1 and extra insert, for MuSIC barcode constructionDepositorInsertCyOFP1
ExpressionMammalianMutationWe introduced some silent mutations to avoid esse…PromoterCMVAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM-mOrange2
Plasmid#228627PurposeMammalian expression of mOrange2 and extra insert, for MuSIC barcode constructionDepositorInsertmOrange2
ExpressionMammalianMutationWe introduced some silent mutations to avoid esse…PromoterCMVAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM-mRuby3
Plasmid#228628PurposeMammalian expression of mRuby3 and extra insert, for MuSIC barcode constructionDepositorInsertmRuby3
ExpressionMammalianMutationWe introduced some silent mutations to avoid esse…PromoterCMVAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
PGK Promoter (MTK 2) (pAN2822)
Plasmid#194224PurposeMammalian Toolkit part 2 encoding the PGK promoterDepositorInsertPGK Promoter
UseSynthetic BiologyPromoterPGKAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only