We narrowed to 9,891 results for: tre promoter
-
Plasmid#120467PurposeBarcoded lentiviral vector to express NEUROG1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-EF1a-double floxed-Aldh1a1-HA-WPRE-HGHpA
Plasmid#184633PurposeExpresses Aldh1a1 fused to HA, driven by the Ef1a promoter, in a Cre-dependent fashionDepositorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-Syk-tSH2-PM
Plasmid#111271Purposeexpress murine Syk tandem SH2 domains (Ser 8 to Gln 264), with Y130E mutation to mimic phosphorylation, in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk tandem SH2 domains (Ser 8 to Gln 264), with Y130E mutation to mimic phosphorylation (Syk Mouse)
ExpressionBacterialMutationY130E mutation to mimic phosphorylationPromoterT7 promoterAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFastBac HT JS-Munc18b
Plasmid#135554PurposeExpress rat Munc18b in Sf9 cells, the resulted plasmid encodes an N-terminally His6-tagged Munc18c protein with a tobacco etch virus (TEV) cleavage site between the His6 tag and Munc18b.DepositorInsertMunc18b (Stxbp2 Rat)
Tags6xHis tag and TEV siteExpressionInsectPromoterpolyhedrin promoterAvailable SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
cARA12-mRFP
Plasmid#181961PurposeARA12 protein tagged with mRFP, under control of TBA2 promoterDepositorAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJL3
Plasmid#184131PurposeFor rescuing null mrp-1 mutation and labelling mrp-1 protein. Intestinal specific Pges-1 promoter drives MRP-1 expression. Translational fusion construct. pPD95.75_Pges-1::mrp-1(isoform C cDNA)::gfp.DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
RCAN1-aa1-150
Plasmid#65412PurposeRCAN1 aa1-150 expression with CMV promoter. Flag tagged.DepositorInsertRCAN1-aa1-150 (Rcan1 Mouse)
TagsFlagExpressionMammalianMutationaa1-150 present, deleted 151 to endAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
CAG-mRuby2(miRE.FF4)-TS.FF6x1-bGH
Plasmid#235297PurposeComMAND open-loop circuit regulating mRuby2, CAG-drivenDepositorInsertmRuby2
UseSynthetic BiologyExpressionMammalianPromoterCAG (synthetic cytomegalovirus early enhancer + c…Available SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-mRuby2(miRE.FF4)-TS.FF4x1-bGH
Plasmid#235298PurposeComMAND closed-loop circuit regulating mRuby2, CAG-drivenDepositorInsertmRuby2
UseSynthetic BiologyExpressionMammalianPromoterCAG (synthetic cytomegalovirus early enhancer + c…Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-mRuby2-bGH
Plasmid#235296PurposeComMAND base gene regulating mRuby2, CAG-drivenDepositorInsertmRuby2
UseSynthetic BiologyExpressionMammalianPromoterCAG (synthetic cytomegalovirus early enhancer + c…Available SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pro::EX1-2(intΔNACs&ΔMYBs):GFP
Plasmid#218572PurposeTranscriptional reporter for ARF7 promoterDepositorInsertAT5G20730 (NPH4 Mustard Weed)
ExpressionPlantMutationMutation genomic sequence 85nt, 86nt from TA to C…Available SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFsynW SYT1-PGM reporter
Plasmid#197278PurposeEncodes for viral expression of Synaptotagmin 1 (SYT1) for use in the RUSH system; visualized with HaloTag. Reporter only (no hook). SYT1 is mutated to disrupt palmitoylation and glycosylation.DepositorInsertSYT1 and HaloTag (Syt1 Rat)
UseLentiviralTagsFLAGMutationT15A, T16A, N24Q, C74A, C75A, C77A, C79A, and C82APromoterhSyn (human synapsin I promoter)Available SinceJuly 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRB133.2
Plasmid#181950PurposeaTc-inducible expression of PhoP with C-terminal mNeonGreen fusion. Also contains mCherry under PhoP-controlled promoter PvirKDepositorInsertPhoP-Salmonella enterica subsp. enterica serovar Typhimurium (AX04_RS23485 PhoP-Salmonella enterica subsp. enterica serovar Typhimurium, Synthetic)
TagsmNeonGreenExpressionBacterialPromoterPhoP-mNG-PLtetO-1; mCherry-PvirK; tetR-J23106Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBABR Bcd-LEXY
Plasmid#182594PurposeDrosophila integration plasmid expressing Bcd-LEXY fusion protein under the maternal tubulin promoter.DepositorAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBS-V7
Plasmid#173796PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Silene latifolia clpP1 gene with the tobacco regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-V6
Plasmid#173795PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Silene conica clpP1 gene with the tobacco regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-V4
Plasmid#173794PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Nicotiana tabacum clpP1 gene with native regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPN455
Plasmid#137872PurposeExpression of gRNA targeting POGZ for CRISPRa; U6 promoterDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only