We narrowed to 10,252 results for: tre promoter
-
Plasmid#120513PurposeBarcoded lentiviral vector to express MYC Thr58Ala in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC Thr58Ala (MYC Human)
UseLentiviralMutationPoint mutation changing Threonine to Alanine at a…PromoterEF1aAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
LV_EF1a_MAPK14-P2A-Hygro_Barcode
Plasmid#170239PurposeBarcoded lentiviral vector to express MAPK14 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-NFIB-T2A-miRFP670
Plasmid#187222PurposeExpresses human NFIB and miRFP670 via T2A linker under control of a CMV promoter.DepositorInsertNuclear Factor I B (NFIB Human)
TagsInserted T2A-miRFP670 at 3' terminal of MCS.ExpressionMammalianPromoterCMVAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC deltaNLS_P2A_Hygro_Barcode
Plasmid#120506PurposeBarcoded lentiviral vector to express c-MYC deltaNLS in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC H84NLS (MYC Human)
UseLentiviralMutationDeletion of nuclear localization signal sequencePromoterEF1aAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC Ser62Ala_P2A_Hygro_Barcode
Plasmid#120514PurposeBarcoded lentiviral vector to express MYC Ser62Ala in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC Ser62Ala (MYC Human)
UseLentiviralMutationPoint mutation changing Serine to Alanine at amin…PromoterEF1aAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMCh2007_pLenti_Syn_mChe-cdc42E7
Plasmid#118620Purposeexpression of mChe-tagged cdc42E7 under pSyn promoter for primary neuronsDepositorInsertcdc42E7 (Cdc42 Mouse)
UseLentiviralTagsmCherryExpressionMammalianMutationchanged cagtctg to ggcataa (667 - 673 nt in 3…Promotersynapsin I (rat)Available SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowG-AURKA-mTurq2
Plasmid#157768PurposeExpression of AuroraA kinase biosensor under CMV promoterDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKlab264-pcDNA3-BRCA1(1314-end)-M1783T-V5-3xFLAG
Plasmid#249017PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the M1783T mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationM1783TPromoterCMV PromoterAvailable SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab211-pcDNA3-BRCA1(1314-end)-L1705R-V5-3xFLAG
Plasmid#249015PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the L1705R mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationL1705RPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab240-pcDNA3-BRCA1(1314-end)-Y1845D-V5-3xFLAG
Plasmid#249016PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the Y1845D mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationY1845DPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab981-pcDNA3-BRCA1(1314-end)-V1736A-V5-3xFLAG
Plasmid#249018PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the V1736A mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationV1736APromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab224-pcDNA3-BRCA1(1314-end)-R1699W-V5-3xFLAG
Plasmid#249019PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the R1699W mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationR1699WPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab223-pcDNA3-BRCA1(1314-end)-R1699Q-V5-3xFLAG
Plasmid#249020PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the R1699Q mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationR1699QPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab228-pcDNA3-BRCA1(1314-end)-S1715R-V5-3xFLAG
Plasmid#249021PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the S1715R mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationS1715RPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab189-pcDNA3-BRCA1(1314-end)-A1708E-V5-3xFLAG
Plasmid#249022PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the A1708E mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationA1708EPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab525-pcDNA3-3xFLAG-V5-BRCA1(1314-end)-WT-STOP
Plasmid#249008PurposeThis plasmid expresses the N-terminally 3x-FLAG tagged BRCT domainDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab521-pcDNA3-3xFLAG-V5-BRCA1(1314-end)-Y1845F-STOP
Plasmid#249009PurposeThis plasmid expresses the N-terminally 3x-FLAG tagged BRCT domain that contains the Y1845F mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationY1845FPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab522-pcDNA3-3xFLAG-V5-BRCA1(1314-end)-Y1845D-STOP
Plasmid#249010PurposeThis plasmid expresses the N-terminally 3x-FLAG tagged BRCT domain that contains the Y1845D mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationY1845DPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab524-pcDNA3-3xFLAG-V5-BRCA1(1314-end)-G1788V-STOP
Plasmid#249011PurposeThis plasmid expresses the N-terminally 3x-FLAG tagged BRCT domain that contains the G1788V mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationG1788VPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only