We narrowed to 24,135 results for: CRISPR
-
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-KLF17-CRa1-MS2
Plasmid#251117PurposesgRNA1 for KLF17 activation cloned into lenti sgRNA(MS2)_puro backboneDepositorInsertsgRNA1 targeting KLF17 promoter (KLF17 Human, Synthetic)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-KLF17-CRa2-MS2
Plasmid#251118PurposesgRNA2 for KLF17 activation cloned into lenti sgRNA(MS2)_puro backboneDepositorInsertsgRNA2 targeting KLF17 promoter (KLF17 Human, Synthetic)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-P-6XPyltRNA-dCas9K1151TAG-IRESPylRS
Plasmid#248695PurposeExpression dead CRISPR/Cas9 with unnatural amino acid incorporated at K1151 residueDepositorInsertdead CRISPR/Cas9 K1151TAG, MbPylRS
UseCRISPRExpressionMammalianPromoterCAGAvailable SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eLaTranC
Plasmid#246932Purposefor HEK293T human cell genome editingDepositorInserteLaTranC
UseCRISPRAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
phU6-LaTranC-sgRNA
Plasmid#246933Purposefor HEK293T human cell genome editingDepositorInsertLaTranC sgRNA
UseCRISPRAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-LaTranC
Plasmid#246931Purposefor HEK293T human cell genome editingDepositorInsertLaTranC
UseCRISPRAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3G-ZIM3-Cas9-P2A-GFP
Plasmid#239605PurposeDoxycycline inducible CRISPRgenee constructDepositorAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW281_dSpRY
Plasmid#244822PurposeMammalian expression of catalytically inactive SpRY Cas9 (dSpRY)DepositorInsertdSpRY Cas9
UseCRISPRTags3xFLAG-SV40 NLS and Nucleoplasmin NLSExpressionMammalianMutationD10A/A61R/H840A/L1111R/D1135L/S1136W/G1218K/E1219…PromoterCAGAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW493_U6-sgRNA-entry
Plasmid#244823PurposeMammalian expression of SpyCas9 single guide RNA with Golden Gate-compatible sgRNA spacerDepositorInsertSpyCas9 single guide RNA
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS484_10xHis_MBP_TEV_dSpRY
Plasmid#244832PurposeBacterial expression of catalytically inactive SpRY Cas9 (dSpRY) for protein purificationDepositorInsertdSpRY Cas9
UseCRISPRTags10xHis-MBPExpressionBacterialMutationD10A/A61R/H840A/L1111R/D1135L/S1136W/G1218K/E1219…PromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS23_10xHis_MBP_TEV_SpG-Cas9
Plasmid#244826PurposeBacterial expression of SpG Cas9 for protein purificationDepositorInsertSpG Cas9
UseCRISPRTags10xHis-MBPExpressionBacterialMutationD1135L/S1136W/G1218K/E1219Q/R1335Q/T1337RPromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS24_10xHis_MBP_TEV_SpRY-Cas9
Plasmid#244827PurposeBacterial expression of SpRY Cas9 for protein purificationDepositorInsertSpRY Cas9
UseCRISPRTags10xHis-MBPExpressionBacterialMutationA61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1…PromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS73_10xHis_MBP_TEV_SpRY-Cas9_2xNLS
Plasmid#244835PurposeBacterial expression of SpRY Cas9 with 2xSV40 nuclear localization sequence for protein purificationDepositorInsertSpRY Cas9
UseCRISPRTags10xHis-MBP and 2xSV40 NLSExpressionBacterialMutationA61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1…PromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS72_10xHis_MBP_TEV_SpG-Cas9_2xNLS
Plasmid#244834PurposeBacterial expression of SpG Cas9 with 2xSV40 nuclear localization sequence for protein purificationDepositorInsertSpG Cas9
UseCRISPRTags10xHis-MBP and 2xSV40 NLSExpressionBacterialMutationD1135L/S1136W/G1218K/E1219Q/R1335Q/T1337RPromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-48xEFNA1 array
Plasmid#236382PurposeExpression of array of 48 crRNAs targeting EFNA1DepositorInsert48xEFNA1 crRNA array (EFNA1 Human)
UseCRISPR and LentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-48xGPBP1 array
Plasmid#236383PurposeExpression of array of 48 crRNAs targeting GPBP1DepositorInsert48xGPBP1 crRNA array (GPBP1 Human)
UseCRISPR and LentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-48xHSPA1A array
Plasmid#236377PurposeExpression of array of 48 crRNAs targeting HSPA1ADepositorInsert48xHSPA1A crRNA array (HSPA1A Human)
UseCRISPR and LentiviralAvailable SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrU6-2-35S
Plasmid#226706PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrU6-2 promoter and Cas9 from CaMV 35S promoter.DepositorInsertCrU6-2
UseCRISPRAvailable SinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-LMNB1
Plasmid#227328PurposeDonor template for mStayGold insertion into the N-terminus of the LMNB1 locus. For nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 (Addgene #207770)DepositorInsertLMNB1 Homology Arms flanking a mStayGold Tag (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mScarlet-MAPRE1
Plasmid#227323PurposeDonor template for mScarlet insertion into the C-terminus of the MAPRE1 locus. For growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 (Addgene #207793)DepositorInsertMAPRE1 Homology Arms flanking a mScarlet Tag (MAPRE1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-KO-Puro-TP53
Plasmid#227319PurposeDonor template for 2A-Puro insertion into the N-terminus of the TP53 locus. For selectable p53 knock-out. To be co-transfected with sgRNA plasmid px330-TP53 (Addgene #227318)DepositorInsertTP53 Homology Arms flanking a 2A-Puro Cassette (TP53 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-EZR
Plasmid#227294PurposeDonor template for mStayGold insertion into the C-terminus of the EZR locus. For membrane visualization. To be co-transfected with sgRNA plasmid px330-EZR (Addgene #227293)DepositorInsertEZR Homology Arms flanking a mStayGold Tag (EZR Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrU6-2-UBI
Plasmid#226707PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrU6-2 promoter and Cas9 from maize ubiquitin (ZmUbi) promoter.DepositorInsertCrU6-2
UseCRISPRAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-H3C2
Plasmid#227334PurposeDonor template for mStayGold insertion into the C-terminus of the H3C2 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 (Addgene #207780)DepositorInsertH3C2 Homology Arms flanking a mStayGold Tag (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-miRFP670nano3-H3C2
Plasmid#227335PurposeDonor template for miRFP670nano3 insertion into the C-terminus of the H3C2 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 (Addgene #207780)DepositorInsertH3C2 Homology Arms flanking a miRFP670nano3 Tag (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-MAP4
Plasmid#227296PurposeDonor template for mStayGold insertion into the N-terminus of the MAP4 locus. For microtubule visualization. To be co-transfected with sgRNAplasmid px330-PITCh-MAP4 (Addgene #227295)DepositorInsertMAP4 Homology Arms flanking a mStayGold Tag (MAP4 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CEP192
Plasmid#227289PurposeDonor template for mStayGold insertion into the C-terminus of the CEP192 locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PITCh-CEP192 (Addgene #227288)DepositorInsertCEP192 Homology Arms flanking a mStayGold Tag (CEP192 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-ARL13B
Plasmid#227277PurposeDonor template for mStayGold insertion into the C-terminus of the ARL13B locus. For cilia visualization. To be co-transfected with sgRNA plasmid pX330-PITCh-ARL13B (Addgene #227276)DepositorInsertARL13B Homology Arms flanking a mStayGold Tag (ARL13B Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Puro-CEP192
Plasmid#227290PurposeDonor template for mStayGold-EFS-Puro insertion into the C-term of CEP192 locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PITCh-CEP192 (Addgene #227288)DepositorInsertCEP192 Homology Arms flanking a mStayGold-EFS-Puro Cassette (CEP192 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only