We narrowed to 24,925 results for: crispr
-
Plasmid#199482PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorInsertGal4vp16/4xnrUAS-mKate2
UseCRISPRAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCJH002_10xHis-MBP-TEVcs-Cas12c(4)_Amp
Plasmid#183069PurposeBacterial protein expression plasmid of wild-type Cas12c_4. This is a R965H version of the Cas12c in Harrington et al., 2020.DepositorInsertCas12c_4
UseCRISPRTagsHis10 and MBPExpressionBacterialMutationWild-typeAvailable sinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
LbCas12a-gRNA_BbsI_CAM
Plasmid#183222PurposeLbCas12a gRNA containing BbsI restriction recognition sites in spacer sequence for Golden Gate AssemblyDepositorInsertLbCas12a guide RNA containing BbsI sites in spacer sequence
UseCRISPRExpressionBacterialAvailable sinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEcCas6
Plasmid#170091Purposeexpresses E. coli type I-E Cas6DepositorInsertE. coli type I-E Cas6
TagsHisExpressionBacterialPromoterT7Available sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMS30: pTarget(PmcCAST)
Plasmid#168163PurposeTarget plasmid containing PmcPSP1 and attachment site for PmcCAST.DepositorInsertsPAM for PmcCAST + PmcPSP1
tRNA-Val
ExpressionBacterialAvailable sinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSN007
Plasmid#102440PurposeFor PCR amplification to create paired gRNAs to clone into Golden Gate gRNA expression vectors (e.g. pSB700 Plasmid #64046)DepositorInsert7SK paired gRNA insert
UseSynthetic BiologyExpressionBacterialAvailable sinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
ACTB-PQR-RFPnols-PQR-loxP-Zeo-loxP
Plasmid#121448PurposeTo make a stable human recombinant cell line; see right thumbnail map image for PQR annotationsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRFPnols-PQR-ZeocinR (ACTB Human)
UseCRISPRExpressionMammalianAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFS_0143-pET30-Fusicatenibacter_saccharivorans
Plasmid#116952PurposeExpresses FsRT-Cas1-Cas2 under pT7lac promoter, encodes FsCRISPR array 1, compatible with classic acquisition readoutDepositorInsertFusicatenibacter saccharivorans RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available sinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
VKG1-gRNA-pX330
Plasmid#108671PurposeCleavage of VKG1 sequence by CRISPR/Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA for VKG1 sequence
UseCRISPRAvailable sinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CD55-full length
Plasmid#220874PurposeExpresses CD55 variant in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCD55 (CD55 Human)
TagsEGFPExpressionMammalianPromoterCMWAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
piggyBAC-U6-GFP-WPRE
Plasmid#200030PurposepiggyBAC vector backbone with GFP for cloning DNA Ticker Tapes and U6 for pegRNAsDepositorTypeEmpty backboneTagsGFPExpressionMammalianPromoterU6, EF1aAvailable sinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_Bfl-1.1
Plasmid#85536PurposeInducible expression of guide RNA (Bfl-1.1) with fluorescent GFP reporterDepositorInsertBfl1.1
UseCRISPR and LentiviralExpressionMammalianPromoterH1tAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28-T7-NlaCas3-NLS-6xHis
Plasmid#180214PurposeExpressing Neisseria lactamica Type I-C Cas3 with NLS and His tag on the C terminus for protein purification in E.ColiDepositorInsertNlaCas3c
Tags6xHis and NLSExpressionBacterialPromoterT7Available sinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYPQ145-ZmUbi-tRNA
Plasmid#158403PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ135-tRNA2.0; assembly of 5 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Adrb1
Plasmid#184294PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting Adrb1DepositorInsertsgRNA-Adrb1
UseAAV and CRISPRExpressionMammalianAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Adra1b
Plasmid#184293PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting Adra1bDepositorInsertssgRNA-Adra1b
sgRNA-Adra1b
UseAAV and CRISPRExpressionMammalianAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ96 AAV-SpABE8e-N-terminus_tracrRNA
Plasmid#211817PurposeAAV vector expressing N-terminal of SpCas9-ABE8e and tracrRNADepositorInsertN-terminus of SpCas9-ABE8e and tracrRNA
UseAAVExpressionMammalianPromoterchicken β-actin promoter and U6 promoterAvailable sinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ100 AAV-SpABE8e-C_terminus-tracrRNA
Plasmid#211818PurposeAAV vector expressing C-terminus of SpCas9-ABE8e with tracrRNADepositorInsertC-terminus of SpCas9-ABE8e and tracrRNA
UseAAVExpressionMammalianPromoterchicken β-actin promoter and U6 promoterAvailable sinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only