We narrowed to 18,223 results for: bon
-
Plasmid#112591PurposeUsed for expression of protein in E. coli as Thrombin cleavable N-termina 6His-tag-MBP fusions. Like pMAT9, but without the second BamHI site in the polylinkerDepositorTypeEmpty backboneTags6His-MBPExpressionBacterialAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pNOC-NLUC
Plasmid#98141PurposeGateway compatible construct for N' terminal fusion or promoter driven NanoLuciferase reporter, hygromycin resistance cassetteDepositorTypeEmpty backboneUseAlgae, nannochloropsisTagsHAAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMAL-c2G
Plasmid#75290PurposeExpresses proteins in the cytoplasm as fusions to maltose-binding proteinDepositorTypeEmpty backboneTagsmaltose-binding proteinExpressionBacterialPromotertacAvailable SinceJuly 20, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pattB-RfB2
Plasmid#62296Purposedocking site transgenesis plasmid for Gateway Cloning and insect transgenesisDepositorTypeEmpty backboneUseUnspecifiedAvailable SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDSAYN
Plasmid#62294Purposedocking site transgenesis plasmid for GoldenGate Cloning and insect transgenesis, YFP-NLS markerDepositorTypeEmpty backboneExpressionInsectAvailable SinceMarch 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
FISSEQ-hgRNA-Design1
Plasmid#100571PurposeFISSEQ-hgRNA-Design1 in a lentiviral backboneDepositorInsertFISSEQ-hgRNA-Design1
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc4-FLAGHISNDHFR
Plasmid#64001PurposePosition 4 transfer plasmid for pST44 polycistronic plasmid suite; N-term cleavable double tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTags6xHis & FLAG; TEV cleavableExpressionBacterialPromoterT7Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc4-FLAGDHFR
Plasmid#63992PurposePosition 4 transfer plasmid for pST44 polycistronic plasmid suite; N-term non-cleavable single tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTagsFLAGExpressionBacterialPromoterT7Available SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc3-HISDHFR
Plasmid#63971PurposePosition 3 transfer plasmid for pST44 polycistronic plasmid suite; N-term non-cleavable single tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTags6xHisExpressionBacterialPromoterT7Available SinceDec. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHK
Plasmid#64187Purposeharbours marker genes HIS3 and LYS2DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc4-DHFRSTR
Plasmid#64004PurposePosition 4 transfer plasmid for pST44 polycistronic plasmid suite; C-term single tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTagsStrep II (STR)ExpressionBacterialPromoterT7Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc4-FLAGNDHFR
Plasmid#63997PurposePosition 4 transfer plasmid for pST44 polycistronic plasmid suite; N-term cleavable single tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTagsFLAG; TEV cleavableExpressionBacterialPromoterT7Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAH3
Plasmid#41827PurposeUsed as a PCR template for tagging yeast proteins with the DHFR tag (c-terminal histag) by homologous recombination and selection for phleomycin resistance.DepositorTypeEmpty backboneUsePcr templateExpressionYeastPromoterTEFAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGGH000
Plasmid#48862PurposeEmpty entry vector for creating GreenGate N-terminal tag + coding sequence + C-terminal tag + terminator modules.DepositorTypeEmpty backboneUseGolden gate compatible cloning vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLUK
Plasmid#64184Purposeharbours marker genes LEU2, URA3 and LYS2DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceAug. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
TAL-3TA4
Plasmid#41472DepositorInsert3TA4
UsePcr cloning vectorAvailable SinceJan. 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHU
Plasmid#64172Purposeharbours marker genes HIS3 and URA3DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLM
Plasmid#64175Purposeharbours marker genes LEU2 and MET17DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceAug. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFGL889
Plasmid#52321PurposeIntroducing ectopic integration at the defined fungal ILV2-locus, based on SRR (Sulfonylurea Resistance Reconstitution).DepositorTypeEmpty backboneUseAgrobacteriumExpressionBacterialAvailable SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc2-FLAGDHFR
Plasmid#63956PurposePosition 2 transfer plasmid for pST44 polycistronic plasmid suite; N-term non-cleavable single tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTagsFLAGExpressionBacterialPromoterT7Available SinceDec. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc2-FLAGHISNDHFR
Plasmid#63965PurposePosition 2 transfer plasmid for pST44 polycistronic plasmid suite; N-term cleavable double tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTags6xHis & FLAG; TEV cleavableExpressionBacterialPromoterT7Available SinceOct. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-cyEGFP
Plasmid#48988Purposefor Cre-lox cassette exchange of C-terminal yEGFP tagged gene sequences into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxTagsyEGFPAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-8XDSR
Plasmid#48981Purposefor Cre-lox cassette exchange of untagged gene sequences together with 8 copies of the core DSR motif into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-c3HA
Plasmid#48989Purposefor Cre-lox cassette exchange of C-terminal 3XHA tagged gene sequences into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxTags3XHA tagAvailable SinceDec. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-3XDSR
Plasmid#48976Purposefor Cre-lox cassette exchange of untagged gene sequences together with 3 copies of the core DSR motif into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
TAL-4GA1
Plasmid#41504DepositorInsert4GA1
UsePcr cloning vectorAvailable SinceJan. 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRET.IIS.IRES-EGFP
Plasmid#1838DepositorTypeEmpty backboneUseCre/Lox and RetroviralExpressionMammalianAvailable SinceApril 26, 2006AvailabilityAcademic Institutions and Nonprofits only -
p201N 1509
Plasmid#55768PurposeContains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 8, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p0AmpBC
Plasmid#237275PurposeEmpty vector for L0 TypeIISDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCTK119
Plasmid#248482PurposeEncodes p15A ori-KanR-LacI-TetR [GFP] as a Type 678 part to be used in the CTK/YTK systemsDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only