We narrowed to 10,769 results for: yeast
-
Plasmid#49176Purposegenomic 12Pk epitope tagging in S. pombeDepositorTypeEmpty backboneTags12PkExpressionYeastAvailable sinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pTH727-CEN-RLuc/staCFLuc
Plasmid#38211DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe last three codons of the full-length Firefly …PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRSII314
Plasmid#35451DepositorTypeEmpty backboneUseYeast centromere vectorPromoterNoneAvailable sinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDS282
Plasmid#34983DepositorInsertcpPDZ–mCherry
ExpressionYeastPromoterTEFAvailable sinceMarch 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-KanMX6-Purg1-3FLAG
Plasmid#19354DepositorInserturg1 promoter
ExpressionYeastAvailable sinceSept. 19, 2008AvailabilityAcademic Institutions and Nonprofits only -
pE5n
Plasmid#17459Purposemodified pENTR vector for N-terminal ECFP tag fusion with your gene of interestDepositorPublicationTypeEmpty backboneUseModified gateway entry vectorTagsECFPExpressionBacterial, Insect, Mammalia…Available sinceMarch 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
pL-rpb1-E1103G
Plasmid#10989DepositorInsertrpb1-E1103G (RPO21 Budding Yeast)
ExpressionBacterial and YeastMutationMutation 3308 A to G in the RPB1 ORF resulting in…Available sinceDec. 16, 2005AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH733-2µ-RLuc/maxCFLuc
Plasmid#40608DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available sinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-C1
Plasmid#125549PurposeGateway compatible N2H assay destination vector with C-terminus tagging of nanoluc fragment1DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment1 attached to c-terminus of Gatew…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDEST-N2H-C2
Plasmid#125559PurposeGateway compatible N2H assay destination vector with C-terminus tagging of nanoluc fragment2DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 attached to c-terminus of Gatew…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMTU-DO-URA-C4
Plasmid#160339PurposeHigh-copy expression vector for K. marxianus, uracil selectionDepositorTypeEmpty backboneUseKluyveromyces marxianusExpressionYeastPromotern/aAvailable sinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGJJ045
Plasmid#183621PurposeabundancePCA plasmid - Contains a barcode landing pad and two fragments of the murine methotrexate-resistant DHFR, the expression of one driven by the CYC promoter and the other by the GPD promoter.DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable sinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
p2B-58
Plasmid#177928PurposeExpresses yeGFP under control of doxycycline-responsive TET4 promoter (contains four rtTA binding sites)DepositorPublicationInsertEGFP
ExpressionBacterial and YeastPromoterTET4 (contains four rtTA binding sites)Available sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKmK.P2
Plasmid#125035PurposeStorage plasmid for K.marxianus promoter; type 2 partDepositorInsertPDC1 promoter
UseSynthetic BiologyExpressionYeastAvailable sinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMVS102_P3-GFP-NATMX6
Plasmid#99048PurposeEGFP reporter with six binding sites for the Zif268 DNA binding domainDepositorInsertsMcIsaac 2014 P3 promoter
eGFP
clonNAT resistance
ExpressionYeastMutationGAL1 promoter with 4 GAL4 sites removed and repla…PromoterMcIsaac 2014 P3 promoterAvailable sinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUD628
Plasmid#103018Purposeexpression of a Cpf1 programming crRNA targetting ADE2 (crADE2-3.S)DepositorAvailable sinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pANCH2-Nat
Plasmid#87249Purposegene for resistance to nourseothricin (Nat) inserted next to the parS segments (INT)DepositorInsertNat
ExpressionYeastAvailable sinceMarch 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHS3
Plasmid#81038PurposeHO endonuclease expressionDepositorInsertNATMX - HO endonuclease
ExpressionYeastPromoterTEFAvailable sinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGZ173 (pFA6a-SL-MNase-kanMX6)
Plasmid#70234PurposeChEC-tagging vector encoding a short linker and aa 83-231 of Mnase in pFA6a-3HA-kanMX6 replacing the 3xHA tag. These vectors retain compatibility with the F2/R1 primer pairs commonly used for epitopeDepositorInsertShort linker and aa 83-231 of Mnase
UseYeast genomic targetingAvailable sinceNov. 18, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by