We narrowed to 8,554 results for: sgRNA
-
Plasmid#137182PurposeAAV genome: expresses the N-terminal of S. aureus v5 AAV-CBE from the Cbh promoter, U6-sgRNADepositorInsertv5 AAV-saCBE N-terminal
UseAAVTagsExpressionMutationCas9 D10APromoterCbhAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE_KKH C-terminal
Plasmid#137184PurposeAAV genome: expresses the C-terminal of S. aureus v5 AAV-CBE, and U6-sgRNA (KKH variant).DepositorInsertv5 AAV-saCBE_KKH C-terminal
UseAAVTagsExpressionMutationE782K;N968K;R1015H conferring recognition of NNNR…PromoterCbhAvailable sinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Blast-sgAMPKa1
Plasmid#138704PurposeExpresses a human AMPKa1-targeting sgRNA and Cas9DepositorInsertsgAMPKa1 human (PRKAA1 Human)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgAMPKa2
Plasmid#138685PurposeExpresses a human AMPKa2-targeting sgRNA and Cas9DepositorInsertsgAMPKa2 human (PRKAA2 Human)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.HA_mCherry-NLS
Plasmid#178209PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.HA and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.S.V5_mCherry-NLS
Plasmid#178211PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNuclear Localization Signal and Ollas.S.V5ExpressionMutationPromotereF1aAvailable sinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.V5.FLAG_NGFR
Plasmid#158250PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.V5.FLAGExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgTh(2)
Plasmid#209198PurposeMutagenesis of ThDepositorInsertTh (Th Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterCMVAvailable sinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCas9-sgVRK1 #4-Blast
Plasmid#199647PurposeExpresses Cas9 and sgRNA guide targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiRCas9-CUG
Plasmid#104183PurposeLentiviral transfer vector that carries U6-driven sgRNA targeting CUG repeats using a modified scaffold (Chen et al. Cell 2013) and CMV-driven PIN-dCas9. Derived from LentiCRISPR v2 (Zhang lab)DepositorInsertU6-CUGsgRNA, EFS-PIN-dCas9
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SpCas9
Plasmid#102851PurposeA single-chain light-controllable dSpCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsp-hGRIN2B-sgRNA; dSpCas9; pdDronpa1 (GRIN2B S. pyogenes, Human, Synthetic)
UseCRISPRTags3X Flag and NLSExpressionMammalianMutationPromoterU6 promoterAvailable sinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHL-H1-ccdB-mEF1a-RiH
Plasmid#60601PurposeCloning vector for CRISPR-sgRNA (into the BamHI-EcoRI site), expresses RFP and hygromycin resistance gene.DepositorInsertsRed Fluorescent Protein
Hygromycin resistance gene
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV312.3
Plasmid#119944PurposeExpresses C-terminal Npu DnaE Intein-SaKKH-BE3, tagRFP, and sgRNA in mammalian cellsDepositorInsertC-Intein (Npu DnaE) - C-terminal (740)SaKKH-BE3
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterCMVAvailable sinceMay 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgAMPKa1
Plasmid#138684PurposeExpresses a human AMPKa1-targeting sgRNA and Cas9DepositorInsertsgAMPKa1 human (PRKAA1 Human)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-Puro
Plasmid#171992PurposeDelivers all prime editing nuclease components in a single, puromycin selectable plasmidDepositorInsertCbH-Cas9-RT-T2A-Puro, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseTagsExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable sinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.VSVg_NGFR
Plasmid#158243PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.NWS.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.PAC
Plasmid#58329PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Puromycin resistance, EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterAvailable sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pACT1:Cas9-GFP, U6:sgTK
Plasmid#122852PurposeExpresses Cas9 fused with GFP and a sgRNA targeting the Cryptosporidium parvum TK geneDepositorInsertsCas9-GFP
U6-sgTK
UseCRISPR; Cas9-gfp plasmid for genome editing of cr…TagseGFPExpressionMutationPromoterCryptosporidium parvum U6 and Cryptosporidium par…Available sinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pACT1:Cas9-GFP, U6:sgUPRT
Plasmid#122853PurposeExpresses Cas9 fused with GFP and a sgRNA targeting the Cryptosporidium parvum UPRT geneDepositorInsertsCas9-GFP
U6-sgUPRT
UseCRISPR; Cas9-gfp plasmid for genome editing of cr…TagseGFPExpressionMutationPromoterCryptosporidium parvum U6 and Cryptosporidium par…Available sinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only